Mapk10 (NM_009158) Mouse Untagged Clone

CAT#: MC209721

Mapk10 (untagged) - Mouse mitogen-activated protein kinase 10 (Mapk10), transcript variant 1, (10ug)



  "NM_009158" in other vectors (5)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms C230008H04Rik; JNK; JNK3; JNK3B1; JNK3B2; p54bSAPK; p493F1; p493F12; SAPK(beta); Ser; Serk2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC209721 representing NM_009158
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAGCCTCCATTTCTTATACTACTGCAGTGAACCAACCTTGGATGTGAAAATTGCCTTTTGTCAGGGAT
TCGATAAACACGTGGATGTGTCATCTATTGCCAAACATTACAACATGAGCAAAAGCAAGGTGGACAACCA
GTTCTACAGTGTGGAAGTGGGGGACTCAACCTTCACCGTTCTTAAGCGCTACCAGAACCTGAAGCCAATT
GGCTCTGGGGCTCAGGGAATAGTCTGTGCTGCGTACGACGCTGTCCTTGACAGAAATGTGGCCATTAAGA
AGCTCAGCAGACCCTTCCAGAACCAAACTCACGCCAAGAGGGCTTACCGGGAGCTGGTCCTCATGAAGTG
TGTGAACCATAAAAACATTATTAGCTTATTAAATGTTTTTACACCCCAGAAAACACTGGAGGAGTTCCAA
GATGTCTACTTAGTGATGGAACTGATGGACGCCAACCTGTGTCAGGTGATTCAGATGGAGCTGGACCACG
AGCGGATGTCTTACTTGCTGTACCAGATGCTGTGTGGCATCAAGCACCTCCACTCCGCTGGGATCATCCA
CAGGGACTTAAAACCCAGTAACATTGTAGTCAAGTCTGATTGCACACTGAAAATCCTCGACTTCGGACTG
GCCAGGACAGCGGGTACAAGCTTCATGATGACTCCGTATGTGGTGACGCGATATTACAGAGCCCCTGAGG
TCATCCTGGGCATGGGCTACAAGGAGAACGTGGACATATGGTCTGTGGGATGCATCATGGGAGAAATGGT
TCGCCACAAAATCCTCTTTCCCGGAAGGGACTATATTGACCAGTGGAACAAAGTCATCGAGCAGCTAGGA
ACTCCGTGTCCAGAGTTCATGAAGAAATTGCAGCCCACAGTCAGAAACTACGTGGAGAATCGGCCCAAGT
ACGCAGGACTCACCTTCCCCAAGCTCTTTCCAGATTCCCTCTTCCCAGCGGATTCTGAGCACAATAAACT
TAAAGCCAGCCAAGCCAGGGATTTGTTGTCTAAGATGTTAGTGATTGACCCAGCGAAGAGGATATCGGTG
GACGACGCACTGCAGCATCCGTACATCAACGTTTGGTACGACCCGGCTGAAGTGGAGGCGCCTCCGCCTC
AGATATATGATAAGCAGCTGGATGAAAGGGAGCACACCATCGAAGAATGGAAAGAACTTATCTACAAGGA
GGTAATGAACTCAGAAGAGAAGACTAAGAATGGCGTAGTCAAAGGCCAGCCCTCGCCTTCAGCACAGGTG
CAGCAGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_009158
Insert Size 1269 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_009158.3, NP_033184.2
RefSeq Size 6604 bp
RefSeq ORF 1269 bp
Locus ID 26414
Gene Summary The protein encoded by this gene is a member of the MAP kinase family. MAP kinases act as integration points for multiple biochemical signals, and thus are involved in a wide variety of cellular processes, such as proliferation, differentiation, transcription regulation and development. This kinase is specifically expressed in a subset of neurons in the nervous system and is activated by threonine and tyrosine phosphorylation. Targeted deletion of this gene in mice suggests that it may have a role in stress-induced neuronal apoptosis. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. A recent study provided evidence for translational readthrough in this gene, and expression of an additional C-terminally extended isoform via the use of an alternative in-frame translation termination codon. [provided by RefSeq, Dec 2017]
Transcript Variant: This variant (2) uses an alternate acceptor splice site at the 3' terminal exon, which causes a frameshift compared to variant 1. The resulting isoform (2, also know as JNK3 alpha1) has a shorter and distinct C-terminus compared to isoform 1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...