Cabp1 (NM_013879) Mouse Untagged Clone
CAT#: MC209829
Cabp1 (untagged) - Mouse calcium binding protein 1 (Cabp1), (10ug)
CNY 2,400.00
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | caldendrin |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC209829 representing NM_013879
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGGCAACTGCGTCAAGTCGCCACTAAGAAACCTCTCAAGAAAGATGCGCCAGGAGGAGAAGACCAGCT ACATGGCGGTGCAGACAAGCGAGGACGGGCTGGCGGATGGCGGCGAGCTCCATGGACCACTCATGATGCT GGCCCAGAACTGTGCGGTCATGCACAACCTGCTGGGTCCCGCCTGCATTTTTCTCCGAAAGGGTTTTGCT GAGAACAGACAACCTGACAGATCGTTACGACCAGAGGAGATTGAAGAGCTCCGAGAGGCCTTCCGAGAAT TTGACAAAGACAAGGATGGTTACATCAACTGCCGGGACCTGGGGAACTGCATGCGCACCATGGGCTACAT GCCCACCGAGATGGAGCTCATTGAGCTGTCTCAGCAGATCAACATGAACCTGGGTGGCCACGTGGATTTT GATGACTTTGTGGAACTGATGGGCCCTAAACTCCTGGCGGAGACGGCAGATATGATTGGTGTAAAGGAGC TGAGAGACGCCTTTCGGGAGTTTGATACCAACGGTGACGGGGAGATAAGTACGAGCGAGCTTCGAGAGGC CATGAGGAAGCTCCTGGGTCATCAGGTGGGACACCGGGACATAGAGGAAATTATCCGAGACGTGGACCTC AATGGAGATGGACGAGTGGACTTTGAAGAGTTTGTCCGGATGATGTCTCGCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Chromatograms |
CHROMATOGRAMS
Sequencher program is needed, download here. |
Restriction Sites | SgfI-MluI |
ACCN | NM_013879 |
Insert Size | 684 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_013879.2, NP_038907.1 |
RefSeq Size | 1181 bp |
RefSeq ORF | 684 bp |
Locus ID | 29867 |
UniProt ID | Q9JLK7 |
Gene Summary | Modulates calcium-dependent activity of inositol 1,4,5-triphosphate receptors (ITPRs). Inhibits agonist-induced intracellular calcium signaling. Enhances inactivation and does not support calcium-dependent facilitation of voltage-dependent P/Q-type calcium channels (By similarity). Causes calcium-dependent facilitation and inhibits inactivation of L-type calcium channels by binding to the same sites as calmodulin in the C-terminal domain of CACNA1C, but has an opposite effect on channel function. Suppresses the calcium-dependent inactivation of CACNA1D (PubMed:17050707, PubMed:17947313). Inhibits TRPC5 channels. Prevents NMDA receptor-induced cellular degeneration (By similarity). Required for the normal transfer of light signals through the retina (PubMed:27822497).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) differs in the 5' UTR and 5' coding region compared to variant 1. The encoded isoform (2) has a distinct N-terminus and is shorter than isoform 1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG224345 | Cabp1 (tGFP-tagged) - Mouse calcium binding protein 1 (Cabp1), (10ug) |
CNY 2,850.00 |
|
MR224345 | Cabp1 (Myc-DDK-tagged) - Mouse calcium binding protein 1 (Cabp1) |
CNY 2,400.00 |
|
MR224345L3 | Lenti ORF clone of Cabp1 (Myc-DDK-tagged) - Mouse calcium binding protein 1 (Cabp1) |
CNY 4,750.00 |
|
MR224345L4 | Lenti ORF clone of Cabp1 (mGFP-tagged) - Mouse calcium binding protein 1 (Cabp1) |
CNY 4,750.00 |