Pttg1 (NM_013917) Mouse Untagged Clone

CAT#: MC209839

Pttg1 (untagged) - Mouse pituitary tumor-transforming gene 1 (Pttg1), transcript variant 2, (10ug)



  "NM_013917" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms AW555095; C87862; Pttg; Pttg3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC209839 representing NM_013917
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCTACTCTTATCTTTGTTGATAAGGATAATGAAGAACCCGGCCGCCGTTTGGCATCTAAGGATGGGT
TGAAGCTGGGCACTGGTGTCAAGGCCTTAGATGGGAAATTGCAGGTTTCAACGCCTCGAGTCGGCAAAGT
GTTCAATGCTCCAGCCGTGCCTAAAGCCAGCAGAAAGGCTTTGGGGACAGTCAACAGAGTTGCCGAAAAG
CCTATGAAGACTGGCAAACCCCTCCAACCAAAACAGCCGACCTTGACTGGGAAAAAGATCACCGAGAAGT
CTACTAAGACACAAAGTTCTGTTCCTGCTCCTGATGATGCCTACCCAGAAATAGAAAAGTTCTTCCCTTT
CAATCCTCTAGACTTTGAGAGTTTTGACCTGCCTGAGGAGCACCAGATCTCACTTCTCCCCTTGAATGGC
GTGCCTCTCATGACCCTGAATGAAGAGAGAGGGCTGGAGAAGCTGCTGCATCTGGGCCCCCCTAGCCCTC
TGAAGACACCCTTTCTATCATGGGAATCTGGTAAGGGAGTCCGTTCAAACTCGGGCTGTAAGCAACTTGT
CACATGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_013917
Insert Size 567 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_013917.2, NP_038945.2
RefSeq Size 1698 bp
RefSeq ORF 567 bp
Locus ID 30939
UniProt ID Q9CQJ7
Gene Summary Regulatory protein, which plays a central role in chromosome stability, in the p53/TP53 pathway, and DNA repair. Probably acts by blocking the action of key proteins. During the mitosis, it blocks Separase/ESPL1 function, preventing the proteolysis of the cohesin complex and the subsequent segregation of the chromosomes. At the onset of anaphase, it is ubiquitinated, conducting to its destruction and to the liberation of ESPL1. Its function is however not limited to a blocking activity, since it is required to activate ESPL1. Negatively regulates the transcriptional activity and related apoptosis activity of p53/TP53. The negative regulation of p53/TP53 may explain the strong transforming capability of the protein when it is overexpressed. May also play a role in DNA repair via its interaction with Ku, possibly by connecting DNA damage-response pathways with sister chromatid separation (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) contains different 5' and 3' terminal exons compared to transcript variant 1, resulting in a shorter isoform (2) with a distinct C-terminus compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...