Il1f5 (NM_019451) Mouse Untagged Clone

CAT#: MC209980

Il1f5 (untagged) - Mouse interleukin 1 family, member 5 (delta) (Il1f5), transcript variant 2, (10ug)



  "NM_019451" in other vectors (4)

CNY 3,990.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms AI413231; Fil1delta; Il-1h3; IL-36Ra; Il1hy1; IL36RN
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC209980 representing NM_019451
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGATGGTTCTGAGTGGGGCACTATGCTTCCGAATGAAGGATTCAGCCTTGAAGGTACTGTATCTGCACA
ATAACCAGCTGCTGGCTGGAGGACTGCACGCAGAGAAGGTCATTAAAGGTGAGGAGATCAGTGTTGTCCC
AAATCGGGCACTGGATGCCAGTCTGTCCCCTGTCATCCTGGGCGTTCAAGGAGGAAGCCAGTGCCTATCT
TGTGGGACAGAGAAAGGGCCAATTCTGAAACTTGAGCCAGTGAACATCATGGAGCTCTACCTCGGGGCCA
AGGAATCAAAGAGCTTCACCTTCTACCGGCGGGATATGGGTCTTACCTCCAGCTTCGAATCCGCTGCCTA
CCCAGGCTGGTTCCTCTGCACCTCACCGGAAGCTGACCAGCCTGTCAGGCTCACTCAGATCCCTGAGGAC
CCCGCCTGGGATGCTCCCATCACAGACTTCTACTTTCAGCAGTGTGACTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_019451
Insert Size 471 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_019451.2, NP_062324.2
RefSeq Size 1759 bp
RefSeq ORF 471 bp
Locus ID 54450
UniProt ID Q9QYY1
Gene Summary Inhibits the activity of interleukin-36 (IL36A,IL36B and IL36G) by binding to receptor IL1RL2/IL-36R and preventing its association with the coreceptor IL1RAP for signaling. Part of the IL-36 signaling system that is thought to be present in epithelial barriers and to take part in local inflammatory response; similar to the IL-1 system with which it shares the coreceptor. Proposed to play a role in skin inflammation. May be involved in the innate immune response to fungal pathogens. May activate an anti-inflammatory signaling pathway by recruiting SIGIRR.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1, 2 and 3 encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...