Clec1b (NM_019985) Mouse Untagged Clone

CAT#: MC210093

Clec1b (untagged) - Mouse C-type lectin domain family 1, member b (Clec1b), transcript variant 1, (10ug)



  "NM_019985" in other vectors (4)

CNY 1,200.00

CNY 3,990.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
Clec1b Antibody - N-terminal region
    • 50 ug

CNY 4,628.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 1810061I13Rik; Clec-2; Clec2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC210093 representing NM_019985
Red=Cloning site Blue=ORF

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCAGGATGAAGATGGGTATATCACTTTAAACATCAAGCCCCGGAAACAAGCTCTCAGCTCAGCGGAAC
CTGCCTCTTCTTGGTGGCGTGTGATGGCTTTAGTTCTGCTGATCTCATCCATGGGGCTGGTTGTTGGACT
CGTGGCTCTGGGGATCATGTCGGTCACACAGCAAAAGTATCTACTGGCGGAGAAGGAAAATCTCTCAGCG
ACTCTGCAACAATTGGCCAAGAAATTCTGCCAAGAGTTGATTAGACAATCAGAAATTAAGACAAAGAGCA
CTTTTGAGCACAAGTGCAGCCCCTGCGCCACGAAGTGGAGATACCATGGAGATAGTTGCTACGGGTTCTT
CAGGCGTAACCTAACATGGGAAGAGAGCAAGCAGTATTGCACTGAGCAGAATGCAACACTTGTGAAGACT
GCCAGCCAGAGCACCCTGGACTACATTGCAGAAAGGATTACTTCAGTCCGTTGGATTGGATTATCACGCC
AGAACTCTAAGAAAGACTGGATGTGGGAGGATAGCTCAGTTCTTCGCAAGAACGGGATTAATCTTTCTGG
GAATACAGAAGAAAACATGAATTGTGCTTATCTTCATAATGGAAAAATCCATCCAGCTTCCTGTAAAGAG
AGACATTACTTAATATGTGAGAGAAATGCTGGCATGACAAGAGTGGACCAACTGCTTTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Chromatograms CHROMATOGRAMS
Sequencher program is needed, download here.
Restriction Sites SgfI-MluI     
ACCN NM_019985
Insert Size 3 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC064054, AAH64054
RefSeq Size 1170 bp
RefSeq ORF 690 bp
Locus ID 56760
UniProt ID Q9JL99
Gene Summary C-type lectin-like receptor that functions as a platelet receptor for the lymphatic endothelial marker, PDPN. After ligand activation, signals via sequential activation of SRC and SYK tyrosine kinases leading to activation of PLCG2.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...