Akr1a1 (NM_021473) Mouse Untagged Clone

CAT#: MC210185

Akr1a1 (untagged) - Mouse aldo-keto reductase family 1, member A4 (aldehyde reductase) (Akr1a4), (10ug)



  "NM_021473" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 2610201A18Rik; Akr1a4
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC210185 representing NM_021473
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGACGGCCTCCAGTGTCCTCCTGCACACTGGACAGAAGATGCCTCTGATTGGTCTGGGGACATGGAAGA
GTGAGCCTGGTCAGGTGAAAGCAGCCATTAAACATGCCCTTAGCGCAGGCTACCGCCACATTGATTGTGC
TTCTGTATATGGCAATGAAACTGAGATTGGGGAGGCCCTGAAGGAGAGTGTGGGGTCAGGCAAGGCAGTC
CCTCGAGAGGAGCTGTTTGTGACATCCAAGCTGTGGAATACTAAGCACCACCCTGAGGATGTAGAACCTG
CCCTCCGGAAGACACTGGCTGATCTGCAACTGGAGTATTTGGACCTCTATTTGATGCACTGGCCTTATGC
CTTTGAGCGGGGAGACAATCCCTTTCCCAAGAATGCCGATGGAACTGTCAGATATGACTCAACTCACTAT
AAAGAGACCTGGAAGGCTCTGGAGGTACTGGTGGCAAAGGGGCTGGTGAAAGCCCTGGGCTTGTCCAACT
TCAACAGTCGGCAGATTGATGATGTCCTCAGTGTGGCCTCTGTGCGCCCAGCTGTCTTGCAGGTGGAATG
CCATCCATACCTGGCTCAGAATGAGCTCATTGCCCACTGTCACGCACGGGGCTTGGAGGTGACTGCTTAT
AGCCCCTTGGGTTCCTCTGACCGTGCTTGGCGCCATCCTGATGAGCCAGTCCTGCTTGAAGAACCAGTAG
TCTTGGCACTAGCTGAAAAACATGGCCGATCTCCAGCTCAGATCTTGCTTAGATGGCAGGTTCAGCGGAA
AGTGATCTGCATCCCCAAAAGCATCAATCCTTCCCGCATCCTTCAGAACATTCAGGTATTTGATTTCACC
TTTAGCCCAGAGGAGATGAAACAATTAGATGCTCTGAACAAAAATTGGCGGTATATTGTGCCCATGATTA
CGGTGGATGGGAAGAGGGTTCCCAGAGATGCTGGACACCCTCTGTATCCCTTTAATGACCCATACTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_021473
Insert Size 978 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_021473.3, NP_067448.1
RefSeq Size 1435 bp
RefSeq ORF 978 bp
Locus ID 58810
UniProt ID Q9JII6
Gene Summary Catalyzes the NADPH-dependent reduction of a wide variety of carbonyl-containing compounds to their corresponding alcohols. Displays enzymatic activity towards endogenous metabolites such as aromatic and aliphatic aldehydes, ketones, monosaccharides and bile acids, with a preference for negatively charged substrates, such as glucuronate and succinic semialdehyde (By similarity) (PubMed:22820017, PubMed:15769935, PubMed:20410296). Plays an important role in ascorbic acid biosynthesis by catalyzing the reduction of D-glucuronic acid and D-glucurono-gamma-lactone (PubMed:20410296, PubMed:15769935, PubMed:22820017). Functions as a detoxifiying enzyme by reducing a range of toxic aldehydes. Reduces methylglyoxal and 3-deoxyglucosone, which are present at elevated levels under hyperglycemic conditions and are cytotoxic (By similarity). Involved in the detoxification of lipid-derived aldehydes like acrolein (By similarity). Plays a role in the activation of procarcinogens, such as polycyclic aromatic hydrocarbon trans-dihydrodiols, and in the metabolism of various xenobiotics and drugs (By similarity). Displays no reductase activity towards retinoids (By similarity).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...