Vkorc1l1 (NM_001001327) Mouse Untagged Clone
CAT#: MC210963
Vkorc1l1 (untagged) - Mouse vitamin K epoxide reductase complex, subunit 1-like 1 (Vkorc1l1), transcript variant 2, (10ug)
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 2310024K08Rik |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC210963 representing NM_001001327
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCGGCGCCCGTCCTGCTGAGAGTGTCGGTGCCGCGTTGGGAACGGGTGGCCCGGTATGCAGTGTGCG CCGCCGGGATCCTGCTCTCCATCTACGCCTACCACGTGGAGCGGGAGAAGGAGAGGGACCCGGAGCACCG GGCCCTCTGCGACCTGGGGCCCTGGGTGAAGTGCTCCGCCGCCCTGGCCTCCAGGCATGACAGCCAGCGC AGTTGCAGCTCTGGTCCTCATGACCTCCTCCATTGTGTCTGTGGTGGGCTCTTTGTACCTGGCCTACATT CTGTACTTTGTGCTGAAAGAGTTTTGCATCATCTGCGTCACCACATATGTGCTGAACTTCCTCCTCCTCA TCATCAATTACAAACGACTAGTTTATTTGAATGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001001327 |
Insert Size | 384 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001001327.2, NP_001001327.1 |
RefSeq Size | 4825 bp |
RefSeq ORF | 384 bp |
Locus ID | 69568 |
Gene Summary | Involved in vitamin K metabolism. Can reduce inactive vitamin K 2,3-epoxide to active vitamin K (in vitro), and may contribute to vitamin K-mediated protection against oxidative stress. Plays a role in vitamin K-dependent gamma-carboxylation of Glu residues in target proteins.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) lacks an alternate exon in the 5' coding region, resulting in a frameshift and an early stop codon, compared to variant 1. It encodes isoform 2, which is shorter and has a distinct C-terminus, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG216232 | Vkorc1l1 (tGFP-tagged) - Mouse vitamin K epoxide reductase complex subunit 1-like 1 (Vkorc1l1) transcript variant 2, (10ug) |
CNY 2,090.00 |
|
MR216232 | Vkorc1l1 (Myc-DDK-tagged) - Mouse vitamin K epoxide reductase complex, subunit 1-like 1 (Vkorc1l1), transcript variant 2 |
CNY 1,900.00 |
|
MR216232L3 | Lenti ORF clone of Vkorc1l1 (Myc-DDK-tagged) - Mouse vitamin K epoxide reductase complex, subunit 1-like 1 (Vkorc1l1), transcript variant 2 |
CNY 3,800.00 |
|
MR216232L4 | Lenti ORF clone of Vkorc1l1 (mGFP-tagged) - Mouse vitamin K epoxide reductase complex, subunit 1-like 1 (Vkorc1l1), transcript variant 2 |
CNY 3,800.00 |
其它Vkorc1l1产品