Cnfn (NM_001081375) Mouse Untagged Clone
CAT#: MC211325
Cnfn (untagged) - Mouse cornifelin (Cnfn), transcript variant 2, (10ug)
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 2210418J09Rik |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC211325 representing NM_001081375
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTCATATCCAGTGACTAGTCAGCCTCAGTGCGCCAACACCTGCTACCAGACACAGCTCAGCGATTGGC ACACGGGCCTCACCGACTGTTGCAACGACATGCCCGTCTGTCTGTGCGGCACTTTCGCCCCGCTGTGCCT GGCCTGCCGCATCTCCGATGACTTTGGGGAGTGCTGCTGTGCGCCCTACCTGCCCGGAGGTCTGCACTCT CTGCGCACCGGCATGAGGGAGCGCTACCACATCCAGGGCTCCGTCGGGCACGACTGGGCTGCCCTCACCT TTTGCCTGCCCTGCGCCCTCTGTCAGATGGCGCGGGAACTGAAAATCCGAGAGTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001081375 |
Insert Size | 336 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001081375.1, NP_001074844.1 |
RefSeq Size | 530 bp |
RefSeq ORF | 336 bp |
Locus ID | 72383 |
UniProt ID | Q6PCW6 |
Gene Summary | Part of the insoluble cornified cell envelope (CE) of stratified squamous epithelia.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) lacks an exon in the 5' coding region and uses a downstream start codon, compared to variant 1. It encodes isoform 2 which has a shorter N-terminus, compared to isoform 1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG214148 | Cnfn (tGFP-tagged) - Mouse cornifelin (Cnfn) transcript variant 2, (10ug) |
CNY 2,090.00 |
|
MR214148 | Cnfn (Myc-DDK-tagged) - Mouse cornifelin (Cnfn), transcript variant 2 |
CNY 1,900.00 |
|
MR214148L3 | Lenti ORF clone of Cnfn (Myc-DDK-tagged) - Mouse cornifelin (Cnfn), transcript variant 2 |
CNY 3,800.00 |
|
MR214148L4 | Lenti ORF clone of Cnfn (mGFP-tagged) - Mouse cornifelin (Cnfn), transcript variant 2 |
CNY 3,800.00 |