Rab38 (NM_028238) Mouse Untagged Clone

CAT#: MC211331

Rab38 (untagged) - Mouse RAB38, member of RAS oncogene family (Rab38), (10ug)



  "NM_028238" in other vectors (4)

CNY 3,600.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (2)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 2310011F14Rik; AU043391; cht
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC211331 representing NM_028238
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCAGACACCTCACAAGGAGCACCTGTACAAGCTGCTGGTGATCGGCGACCTGGGTGTGGGCAAGACCA
GCATTATCAAGCGCTATGTGCACCAAAACTTCTCCTCGCACTACCGGGCCACCATTGGTGTGGACTTCGC
GCTGAAGGTGCTCCACTGGGACCCAGAGACGGTGGTGCGCTTGCAGCTCTGGGACATTGCTGGTCAAGAA
AGATTTGGAAACATGACAAGAGTTTATTACCGGGAAGCTATGGGGGCATTTATTGTTTTTGATGTCACCA
GACCAGCCACATTTGAAGCCGTGGCAAAGTGGAAAAATGATTTGGACTCAAAGTTAACGCTCCCTAATGG
TAAGCCAGTGTCAGTGGTTCTGTTGGCCAACAAATGTGACCAAGGGAAGGATGTGCTTATGAACAATGGA
CTCAAGATGGACCAGTTCTGCAAGGAGCATGGCTTCGTAGGATGGTTTGAAACATCAGCCAAGGAAAACA
TAAACATTGATGAAGCCTCAAGATGCCTGGTCAAGCACATACTTGCAAATGAGTGTGACCTCCTAGAGTC
TATAGAACCGGACATTGTGAAGCCCCATCTCACATCGCCCAAGGTTGTCAGCTGCTCTGGCTGTGCCAAA
TCCTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Chromatograms CHROMATOGRAMS
Sequencher program is needed, download here.
Restriction Sites SgfI-MluI     
ACCN NM_028238
Insert Size 636 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC089578, AAH89578
RefSeq Size 1577 bp
RefSeq ORF 636 bp
Locus ID 72433
UniProt ID Q8QZZ8
Gene Summary Plays a role in the maturation of phagosomes that engulf pathogens, such as S.aureus and Mycobacterium (By similarity). May be involved in melanosomal transport and docking. Involved in the proper sorting of TYRP1. Involved in peripheral melanosomal distribution of TYRP1 in melanocytes; the function, which probably is implicating vesicle-trafficking, includes cooperation with ANKRD27 and VAMP7 (PubMed:21187289). Plays an important role in the control of melanin production and melanosome biogenesis (By similarity). In concert with RAB32, regulates the proper trafficking of melanogenic enzymes TYR, TYRP1 and DCT/TYRP2 to melanosomes in melanocytes (PubMed:26620560).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...