Deptor (NM_145470) Mouse Untagged Clone
CAT#: MC212028
Deptor (untagged) - Mouse DEP domain containing MTOR-interacting protein (Deptor), transcript variant 1, (10ug)
CNY 3,656.00
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | Depdc6 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC212028 representing NM_145470
Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Chromatograms |
CHROMATOGRAMS
![]() Sequencher program is needed, download here. |
Restriction Sites | SgfI-MluI |
ACCN | NM_145470 |
Insert Size | 1230 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_145470.2, NP_663445.2 |
RefSeq Size | 1890 bp |
RefSeq ORF | 1230 bp |
Locus ID | 97998 |
UniProt ID | Q570Y9 |
Gene Summary | Negative regulator of the mTORC1 and mTORC2 signaling pathways. Inhibits the kinase activity of both complexes (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (a). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG225045 | Deptor (tGFP-tagged) - Mouse DEP domain containing 6 (Depdc6) transcript variant 1, (10ug) |
CNY 5,256.00 |
|
MR225045 | Deptor (Myc-DDK-tagged) - Mouse DEP domain containing MTOR-interacting protein (Deptor), transcript variant 1 |
CNY 3,656.00 |
|
MR225045L3 | Lenti ORF clone of Deptor (Myc-DDK-tagged) - Mouse DEP domain containing MTOR-interacting protein (Deptor), transcript variant 1 |
CNY 4,750.00 |
|
MR225045L4 | Lenti ORF clone of Deptor (mGFP-tagged) - Mouse DEP domain containing MTOR-interacting protein (Deptor), transcript variant 1 |
CNY 4,750.00 |