0610010K14Rik (NM_001177607) Mouse Untagged Clone
CAT#: MC212102
0610010K14Rik (untagged) - Mouse RIKEN cDNA 0610010K14 gene (0610010K14Rik), transcript variant 6, (10ug)
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 1110020A23Rik; AL033328; AU045833; Bap18 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC212102 representing NM_001177607
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGACGTCAGCGTCCACCAAGGTTGGAGAGATCTTCTCCGCGGCCGGCGCCGCCTTCACGAAGCTCGGGG AGTTGACGATGCAGCTGCATCCAGTCTCGGACTCTTCCCCTGCCGGGGCTCAGATAAAGACCACTGTGAA GCGAAAAGTGTATGAAGACTCCGGCATCCCCCTTCCAGCTGAGTCACCCAAGAAAGGACCCAAGAAGATG ACGTCCGGTGTCCTCTCACCTCCAAACGCCCCTCCACCCAGCAGCTCCAGTGTCCCTGAAGCTGGGGTTC CTCCCATAAAGAAACAGAAGGCTGGTGAGGGCTGTGGAGTTGCTGCCTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001177607 |
Insert Size | 330 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001177607.1, NP_001171078.1 |
RefSeq Size | 725 bp |
RefSeq ORF | 330 bp |
Locus ID | 104457 |
UniProt ID | Q9DCT6 |
Gene Summary | Component of chromatin complexes such as the MLL1/MLL and NURF complexes.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (6) lacks two alternate, in-frame exons and uses a different splice site in the 3' UTR, compared to variant 1. The resulting protein (isoform 6) has a shorter and distinct C-terminue when it is compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG220850 | 0610010K14Rik (tGFP-tagged) - Mouse RIKEN cDNA 0610010K14 gene (0610010K14Rik) transcript variant 6, (10ug) |
CNY 2,090.00 |
|
MR220850 | 0610010K14Rik (Myc-DDK-tagged) - Mouse RIKEN cDNA 0610010K14 gene (0610010K14Rik), transcript variant 6 |
CNY 1,900.00 |
|
MR220850L3 | Lenti ORF clone of 0610010K14Rik (Myc-DDK-tagged) - Mouse RIKEN cDNA 0610010K14 gene (0610010K14Rik), transcript variant 6 |
CNY 3,800.00 |
|
MR220850L4 | Lenti ORF clone of 0610010K14Rik (mGFP-tagged) - Mouse RIKEN cDNA 0610010K14 gene (0610010K14Rik), transcript variant 6 |
CNY 3,800.00 |
其它0610010K14Rik产品