Gpx4 (NM_008162) Mouse Untagged Clone
CAT#: MC215241
Gpx4 (untagged) - Mouse glutathione peroxidase 4 (Gpx4), transcript variant 2, (10ug), (Note: selenocysteine protein, Internal stop codon present. see reference data summary below)
CNY 3,784.00
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Synonyms | GPx-4; GSHPx-4; mtPHG; mtPHGPx; PHG; PHGPx; sn; snGPx |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC215241 representing NM_008162
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGAGCTGGGGCCGTCTGAGCCGCTTACTTAAGCCAGCACTGCTGTGCGGGGCTCTGGCTGCGCCTGGTC TGGCAGGCACCATGTGTGCATCCCGCGATGATTGGCGCTGTGCGCGCTCCATGCACGAATTCTCAGCCAA GGACATCGACGGGCACATGGTCTGCCTGGATAAGTACAGGGGTTTCGTGTGCATCGTCACCAACGTGGCC TCGCAATGAGGCAAAACTGACGTAAACTACACTCAGCTAGTCGATCTGCATGCCCGATATGCTGAGTGTG GTTTACGAATCCTGGCCTTCCCCTGCAACCAGTTTGGGAGGCAGGAGCCAGGAAGTAATCAAGAAATCAA GGAGTTTGCAGCCGGCTACAACGTCAAGTTTGACATGTACAGCAAGATCTGTGTAAATGGGGACGATGCC CACCCACTGTGGAAATGGATGAAAGTCCAGCCCAAGGGCAGGGGCATGCTGGGAAATGCCATCAAATGGA ACTTTACCAAGTTTCTCATTGATAAGAACGGCTGCGTGGTGAAGCGCTATGGTCCCATGGAGGAGCCCCA GGTGATAGAGAAGGACCTGCCGTGCTATCTCTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_008162 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). The expression of this clone is not guaranteed due to the nature of selenoproteins. |
OTI Annotation | This clone encodes a selenoprotein containing the rare amino acid selenocysteine (Sec). Sec is encoded by UGA codon, which normally signals translational termination. Expression of this clone is not guaranteed due to the nature of selenoproteins. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_008162.3, NP_032188.3 |
RefSeq Size | 974 bp |
RefSeq ORF | 594 bp |
Locus ID | 625249 |
UniProt ID | O70325 |
Gene Summary | The protein encoded by this gene belongs to the glutathione peroxidase family, members of which catalyze the reduction of hydrogen peroxide, organic hydroperoxides and lipid hydroperoxides, and thereby protect cells against oxidative damage. Several isozymes of this gene family exist in vertebrates, which vary in cellular location and substrate specificity. This isozyme has a high preference for lipid hydroperoxides and protects cells against membrane lipid peroxidation and cell death. It is also required for normal sperm development; thus, it has been identified as a 'moonlighting' protein because of its ability to serve dual functions as a peroxidase, as well as a structural protein in mature spermatozoa. Disruption of this gene in mouse spermatocytes is associated with male infertility. This isozyme is also a selenoprotein, containing the rare amino acid selenocysteine (Sec) at its active site. Sec is encoded by the UGA codon, which normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, designated the Sec insertion sequence (SECIS) element, that is necessary for the recognition of UGA as a Sec codon, rather than as a stop signal. Transcript variants resulting from alternative splicing or use of alternate promoters have been described to encode isoforms with different subcellular localization. Pseudogenes of this locus have been identified on chromosomes 10 and 17. [provided by RefSeq, Jan 2019] Transcript Variant: This variant (1) represents the predominant transcript and encodes the canonical isoform A (also known as phGPx). A similar isoform in rat(L-form) has been shown to be localized to the mitochondria (PMID:9988735). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG222317 | Gpx4 (GFP-tagged) - Mouse glutathione peroxidase 4 (Gpx4) transcript variant 2, (10ug), (Note: selenocysteine protein, Internal stop codon present. see reference data summary below) |
CNY 3,504.00 |
|
MR222317 | Dio1 (Myc-DDK-tagged) - Mouse deiodinase, iodothyronine, type I (Dio1), (10ug), (Note: selenocysteine protein, Internal stop codon present. see reference data summary below) |
CNY 1,904.00 |