Mymx (NM_001177469) Mouse Untagged Clone
CAT#: MC215330
Gm7325 (untagged) - Mouse predicted gene 7325 (Gm7325), transcript variant 2, (10ug)
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | EG653016; Esgp; Gm7325; minion; myomerger |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC215330 representing NM_001177469
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGCCCGTTCCATTGCTCCCGATGGTGCTTCGATCGCTGCTGTCCCGCCTGCTGCTGCCTGTTGCCCGCC TGGCCCGGCAGCACCTCCTGCCCTTGCTGCGCCGGCTGGCCCGCCGACTGAGCTCCCAAGACATGAGAGA GGCTCTGCTGAGCTGTCTGCTCTTTGTCCTCAGCCAGCAACAGCCACCGGATTCTGGAGAGGCCTCCAGA GTGGACCACTCCCAGAGGAAGGAGAGATTGGGCCCCCAGAAGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001177469 |
Insert Size | 255 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001177469.1, NP_001170940.1 |
RefSeq Size | 811 bp |
RefSeq ORF | 255 bp |
Locus ID | 653016 |
UniProt ID | Q2Q5T5 |
Gene Summary | Myoblast-specific protein that mediates myoblast fusion, an essential step for the formation of multi-nucleated muscle fibers (PubMed:28386024, PubMed:28569745, PubMed:28569755, PubMed:30197239). Involved in membrane fusion downstream of the lipid mixing step mediated by MYMK (PubMed:30197239). Acts by generating membrane stresses via its extracellular C-terminus, leading to drive fusion pore formation (PubMed:30197239). Acts independently of MYMK (PubMed:30197239). Involved in skeletal muscle regeneration in response to injury by mediating the fusion of satellite cells, a population of muscle stem cells, with injured myofibers (PubMed:29581287).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) uses an alternate donor splice site at 5' non-coding exon compared to variant 1. Variants 1 and 2 encode the same isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG223821 | Gm7325 (tGFP-tagged) - Mouse predicted gene 7325 (Gm7325) transcript variant 2, (10ug) |
CNY 2,090.00 |
|
MR223821 | Gm7325 (Myc-DDK-tagged) - Mouse predicted gene 7325 (Gm7325), transcript variant 2 |
CNY 1,900.00 |
|
MR223821L1 | Lenti ORF clone of Gm7325 (Myc-DDK-tagged) - Mouse predicted gene 7325 (Gm7325), transcript variant 2 |
CNY 3,720.00 |
|
MR223821L2 | Lenti ORF clone of Gm7325 (mGFP-tagged) - Mouse predicted gene 7325 (Gm7325), transcript variant 2 |
CNY 3,800.00 |
|
MR223821L3 | Lenti ORF clone of Gm7325 (Myc-DDK-tagged) - Mouse predicted gene 7325 (Gm7325), transcript variant 2 |
CNY 3,800.00 |
|
MR223821L4 | Lenti ORF clone of Gm7325 (mGFP-tagged) - Mouse predicted gene 7325 (Gm7325), transcript variant 2 |
CNY 3,800.00 |