Ednrb (NM_007904) Mouse Untagged Clone

CAT#: MC215781

Ednrb (untagged) - Mouse endothelin receptor type B (Ednrb), transcript variant 1, (10ug)



  "NM_007904" in other vectors (4)

CNY 5,700.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (2)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms ET-B; ET-BR; ETb; ETR-; ETR-b; Sox10; Sox10m1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC215781 representing NM_007904
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCAATCGCCCGCAAGCCGGTGCGGACGCGCCTTGGTGGCGCTGCTGCTGGCCTGTGGCTTCTTGGGGG
TATGGGGAGAGAAAAGAGGATTCCCACCTGCCCAAGCCACGCTGTCACTTCTCGGGACTAAAGAGGTAAT
GACGCCACCCACTAAGACCTCCTGGACCAGAGGTTCCAACTCCAGTCTGATGCGTTCCTCCGCACCTGCG
GAGGTGACCAAAGGAGGGAGGGGGGCTGGAGTCCCGCCAAGATCCTTCCCTCCTCCGTGCCAACGAAATA
TTGAGATCAGCAAGACTTTTAAATACATCAACACGATTGTGTCGTGCCTCGTGTTCGTGCTAGGCATCAT
CGGGAACTCCACGCTGCTAAGAATCATCTACAAGAACAAGTGCATGCGCAATGGTCCCAATATCTTGATC
GCCAGTCTGGCTCTGGGAGACCTACTGCACATCATCATAGACATACCCATTAACACCTACAAGTTGCTCG
CAGAGGACTGGCCATTTGGAGCTGAGATGTGTAAGCTGGTGCCCTTCATACAGAAGGCTTCTGTGGGAAT
CACAGTGCTGAGTCTTTGTGCTCTAAGTATTGACAGATATCGAGCTGTTGCTTCTTGGAGTCGAATTAAA
GGAATTGGGGTTCCAAAATGGACAGCAGTAGAAATTGTTTTAATTTGGGTGGTCTCTGTGGTTCTGGCTG
TCCCCGAAGCCATAGGTTTTGATATGATTACGTCGGACTACAAAGGAAAGCCCCTAAGGGTCTGCATGCT
TAATCCCTTTCAGAAAACAGCCTTCATGCAGTTTTACAAGACAGCCAAAGATTGGTGGCTGTTCAGTTTC
TACTTCTGCTTGCCGCTAGCCATCACTGCAGTCTTTTATACCCTGATGACCTGCGAAATGCTCAGGAAGA
AGAGCGGTATGCAGATTGCTTTGAATGATCACTTAAAGCAGAGACGAGAAGTGGCCAAGACAGTCTTCTG
CCTGGTCCTCGTGTTTGCTCTCTGTTGGCTTCCCCTTCACCTCAGCCGGATCCTGAAGCTCACCCTGTAT
GACCAGAGCAATCCACACAGGTGTGAGCTTCTGAGCTTTTTGTTGGTTTTGGACTACATTGGTATCAACA
TGGCTTCTTTGAACTCCTGCATCAATCCAATCGCTCTGTATTTGGTGAGCAAAAGATTCAAAAACTGCTT
TAAGTCATGTTTGTGCTGCTGGTGCCAAACGTTTGAGGAAAAGCAGTCCTTGGAGGAGAAGCAGTCCTGC
CTGAAGTTCAAAGCCAACGATCACGGATATGACAACTTCCGGTCCAGCAATAAATACAGCTCGTCTTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_007904
Insert Size 1329 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_007904.4, NP_031930.1
RefSeq Size 4005 bp
RefSeq ORF 1329 bp
Locus ID 13618
UniProt ID P48302
Gene Summary This gene encodes a member of the G-protein coupled receptor family. It encodes a receptor for endothelins, peptides that are involved in vasocontriction. The encoded protein activates a phosphatidylinositol-calcium second messenger system and is required for the development of enteric neurons and melanocytes. Gene disruption causes pigmentation anomalies, deafness, and abnormal dilation of the colon due to defects of neural crest-derived cells. Mutations in this gene are found in the piebald mouse, and mouse models of Hirschsprung's disease and Waardenburg syndrome type 4. Renal collecting duct-specific gene deletion causes sodium retention and hypertension. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
Transcript Variant: This variant (1) differs in the 5' UTR compared to variant 2. Variants 1, 2, and 3 encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...