United States
Germany
Japan
United Kingdom
China
Map2k4 (BC029833) Mouse Untagged Clone
CAT＃: MC217773
Map2k4 (untagged) - Mouse mitogen activated protein kinase kinase 4 (cDNA clone MGC:36532 IMAGE:3962163), (10ug)
CNY 6,940.00
| Cited in 2 publications. |
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | MEK4, MKK4, Sek1, JNKK1, PRKMK4 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>BC029833
Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGTCCACAAACCAAGTGGGCAGATAATGGCAGTTAAAAGAATTCGGTCAACTGTGGATGAAAAAGAAC AAAAACAACTTCTCATGGATTTGGATGTAGTAATGCGGAGTAGTGATTGCCCATACATTGTTCAGTTCTA TGGTGCACTCTTCAGAGAGGGCGACTGTTGGATCTGTATGGAGCTCATGTCTACCTCGTTCGATAAGTTT TACAAATATGTATATAGTGTGTTAGATGACGTTATTCCGGAAGAGATCTTAGGCAAAATCACTTTAGCAA CTGTGAAAGCACTAAACCACTTAAAAGAAAACTTGAAAATTATTCACAGAGACATCAAACCTTCCAATAT TCTTCTGGACAGAAGTGGAAATATAAAGCTCTGTGATTTCGGCATCAGTGGACAGCTTGTGGACTCTATT GCCAAGACAAGAGATGCTGGGTGTAGGCCGTATATGGCACCTGAAAGAATAGACCCAAGTGCATCAAGAC AAGGGTATGATGTCCGCTCTGATGTCTGGAGTTTGGGGATCACATTGTACGAGTTGGCCACAGGCCGATT TCCTTATCCAAAGTGGAATAGTGTATTTGATCAGCTAACACAAGTGGTGAAAGGAGACCCTCCGCAGCTG AGTAATTCTGAAGAAAGGGAGTTCTCCCCCAGTTTCATCAACTTTGTCAACTTGTGCCTTACGAAGGATG AATCCAAAAGGCCAAAGTATAAAGAGCTTCTGAAACATCCCTTTATTTTGATGTATGAAGAACGTACTGT AGAGGTCGCATGCTATGTTTGTAAAATCCTGGATCAGATGCCAGCCACTCCCAGCTCGCCCATGTATGTC GACTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | BC029833 |
| Insert Size | 846 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC029833, AAH29833 |
| RefSeq Size | 2397 bp |
| RefSeq ORF | 845 bp |
| Locus ID | 26398 |
| Gene Summary | Dual specificity protein kinase which acts as an essential component of the MAP kinase signal transduction pathway. Essential component of the stress-activated protein kinase/c-Jun N-terminal kinase (SAP/JNK) signaling pathway. With MAP2K7/MKK7, is the one of the only known kinase to directly activate the stress-activated protein kinase/c-Jun N-terminal kinases MAPK8/JNK1, MAPK9/JNK2 and MAPK10/JNK3. MAP2K4/MKK4 and MAP2K7/MKK7 both activate the JNKs by phosphorylation, but they differ in their preference for the phosphorylation site in the Thr-Pro-Tyr motif. MAP2K4 shows preference for phosphorylation of the Tyr residue and MAP2K7/MKK7 for the Thr residue. The phosphorylation of the Thr residue by MAP2K7/MKK7 seems to be the prerequisite for JNK activation at least in response to proinflammatory cytokines, while other stimuli activate both MAP2K4/MKK4 and MAP2K7/MKK7 which synergistically phosphorylate JNKs. MAP2K4 is required for maintaining peripheral lymphoid homeostasis. The MKK/JNK signaling pathway is also involved in mitochondrial death signaling pathway, including the release cytochrome c, leading to apoptosis. Whereas MAP2K7/MKK7 exclusively activates JNKs, MAP2K4/MKK4 additionally activates the p38 MAPKs MAPK11, MAPK12, MAPK13 and MAPK14.[UniProtKB/Swiss-Prot Function] |
Citations (2)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
Truncation- and motif-based pan-cancer analysis reveals tumor-suppressing kinases
,null,
Science signaling
,PubMed ID 29666306
[Map2k4]
|
|
Diverse somatic mutation patterns and pathway alterations in human cancers.
,null,
Nature
,PubMed ID 20668451
[Map2k4]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG203798 | Map2k4 (tGFP-tagged) - Mouse mitogen activated protein kinase kinase 4 (cDNA clone MGC:36532 IMAGE:3962163) |
CNY 2,850.00 |
|
| MR203798 | Map2k4 (Myc-DDK-tagged) - Mouse mitogen activated protein kinase kinase 4 (cDNA clone MGC:36532 IMAGE:3962163) |
CNY 2,400.00 |
|
| MR203798L3 | Lenti ORF clone of Map2k4 (Myc-DDK-tagged) - Mouse mitogen activated protein kinase kinase 4 (cDNA clone MGC:36532 IMAGE:3962163) |
CNY 4,750.00 |
|
| MR203798L4 | Lenti ORF clone of Map2k4 (mGFP-tagged) - Mouse mitogen activated protein kinase kinase 4 (cDNA clone MGC:36532 IMAGE:3962163) |
CNY 4,750.00 |
