Suv39h2 (BC032960) Mouse Untagged Clone

CAT#: MC218355

Suv39h2 (untagged) - Mouse suppressor of variegation 3-9 homolog 2 (Drosophila) (cDNA clone MGC:41074 IMAGE:1330053), (10ug)



  "BC032960" in other vectors (4)

CNY 6,940.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 4930507K23Rik; AA536750; D030054H19Rik; D2Ertd544e; KMT1B
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC032960
Red=Cloning site Blue=ORF Green=Tags(s)

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCGGCGGCCAGGGCCAAGGCACGGGGCAGTGAGGCAGGAGCGCGGTGTCACCGGGCTCCAGGTCCGC
CCCCGAGGCCCAAGGCCAGGCGAACGGCGAGACGCCGCCGCGCGGAGACCCTGACGGCGCGACGCTCGCG
GCCGTCTGCGGGCGAGAGGCGCGCCGGCTCCCAGCGAGCGTGGTCCGGAGCTCCGCGGGCCGCGGTCTTT
GGCGACGAGTGTGCACGAGGTGCCTTATTCAAGGCCTGGTGTGTGCCTTGCCTAGTTTCACTTGATACTC
TCCAGGAATTATGTAGAAAAGAAAAGCTCACATGTAAATCGATTGGAATCACCAAAAGGAATCTAAACAA
TTATGAGGTGGAGTACTTGTGTGACTACAAGGTAGCAAAGGTGATCACAAGTGAAGAGGCCGAGAGACGG
GGACAGTTCTATGACAACAAAGGGATCACCTACCTCTTTGACCTGGACTACGAGTCTGATGAGTTCACAG
TGGATGCAGCTCGATATGGAAACGTATCCCATTTTGTGAATCATAGTTGTGACCCAAATCTTCAGGTGTT
TAGTGTTTTCATCGATAACCTTGATACTCGGCTGCCCAGGATAGCATTGTTCTCTACAAGAACCATAAAC
GCTGGAGAAGAGCTGACTTTTGACTATCAAATGAAAGGTTCTGGAGAAGCATCTTCAGACTCCATTGACC
ACAGCCCTGCCAAAAAAAGGGTCAGAACCCAATGTAAATGTGGAGCCGAGACTTGCAGAGGTTACCTCAA
CTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAG
GTTTAA
Restriction Sites SgfI-MluI     
ACCN BC032960
Insert Size 774 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC032960, AAH32960
RefSeq Size 1856 bp
RefSeq ORF 773 bp
Locus ID 64707
Gene Summary Histone methyltransferase that specifically trimethylates 'Lys-9' of histone H3 using monomethylated H3 'Lys-9' as substrate. H3 'Lys-9' trimethylation represents a specific tag for epigenetic transcriptional repression by recruiting HP1 (CBX1, CBX3 and/or CBX5) proteins to methylated histones. Mainly functions in heterochromatin regions, thereby playing a central role in the establishment of constitutive heterochromatin at pericentric and telomere regions. H3 'Lys-9' trimethylation is also required to direct DNA methylation at pericentric repeats. SUV39H1 is targeted to histone H3 via its interaction with RB1 and is involved in many processes, such as cell cycle regulation, transcriptional repression and regulation of telomere length. May participate in regulation of higher-order chromatin organization during spermatogenesis. Recruited by the large PER complex to the E-box elements of the circadian target genes such as PER2 itself or PER1, contributes to the conversion of local chromatin to a heterochromatin-like repressive state through H3 'Lys-9' trimethylation.[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...