Mpst (NM_001162493) Mouse Untagged Clone

CAT#: MC218767

Mpst (untagged) - Mouse mercaptopyruvate sulfurtransferase (Mpst), nuclear gene encoding mitochondrial protein, transcript variant 3, (10ug)



  "NM_001162493" in other vectors (5)

CNY 6,940.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms Mst
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC218767 representing NM_001162493
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCCGCCCCGCAACTTTTCCGAGCTCTGGTGTCTGCGCAGTGGGTGGCGGAGGCTCTGAAGGCCCCGC
GCTCCTCACAGCCGCTGAAGTTACTGGACGCGTCCTGGTACCTACCCAAGCTGGGCCGCGATGCACGACG
CGAGTTTGAGGAGCGCCACATCCCGGGCGCCGCCTTCTTCGACATCGATCGTTGCAGTGACCACACGTCC
CCCTACGACCACATGCTGCCTAACGCCACGCACTTTGCCGACTACGCGGGCAGCTTGGGCGTGAGCGCCG
CCACGCACGTCGTGATCTACGACGACAGTGACCAGGGCCTCTATTCCGCTCCGCGGGTCTGGTGGATGTT
CCGCGCCTTCGGCCACCACTCTGTGTCATTGCTGGACGGCGGCTTCCGCCACTGGCTGAATCAGAACCTG
CCAATCAGCTCCGGCAAAAGCCACTCGGAGCCCGCGGAGTTCAGCGCGCAGCTCGATCCCTCTTTCATCA
AGACCCACGAGGACATCCTGGAGAACTTGGATGCCCGGCGCTTCCAGGTGGTGGACGCCCGCGCAGCTGG
CCGTTTCCAAGGCACCCAGCCAGAACCCCGAGATGGCATCGAACCTGGCCACATCCCTGGCTCAGTAAAC
ATCCCGTTCACTGAATTCCTGACCAACGAAGGCCTGGAGAAGAGCCCAGAGGAGATCAAACGCCTGTTTA
AGGAGAAGAAGGTGGACCTGTCTAAGCCCTTGGTAGCCACGTGTGGCTCCGGTGTCACAGCCTGCCACGT
GGTCCTGGGGGCCTTCCTCTGTGGCAAGTCAGACGTGCCTGTCTATGATGGCTCCTGGGTAGAGTGGTAC
ATGCGTGCCCAGCCAGAGCATATCATCTCTGAGGGCCGAGGGAAGACCCAGTGA


AGCGGACCGACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCC
TGGATTACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-RsrII     
ACCN NM_001162493
Insert Size 894 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001162493.1, NP_001155965.1
RefSeq Size 1292 bp
RefSeq ORF 894 bp
Locus ID 246221
UniProt ID Q99J99
Gene Summary Transfer of a sulfur ion to cyanide or to other thiol compounds. Also has weak rhodanese activity. Detoxifies cyanide and is required for thiosulfate biosynthesis. Acts as an antioxidant. In combination with cysteine aminotransferase (CAT), contributes to the catabolism of cysteine and is an important producer of hydrogen sulfide in the brain, retina and vascular endothelial cells. Hydrogen sulfide H(2)S is an important synaptic modulator, signaling molecule, smooth muscle contractor and neuroprotectant. Its production by the 3MST/CAT pathway is regulated by calcium ions.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) differs in the 5' UTR compared to variant 1. Variants 1, 2 and 3 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...