United States
Germany
Japan
United Kingdom
China
Ar (NM_013476) Mouse Untagged Clone
CAT＃: MC222457
Ar (untagged) - Mouse androgen receptor (Ar), (10ug)
CNY 6,592.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | AW320017; Tfm |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC222457 representing NM_013476
Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC AGCGGACCGACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCC TGGATTACAAGGATGACGACGATAAGGTTTAA |
| Chromatograms |
CHROMATOGRAMS
 Sequencher program is needed, download here. |
| Restriction Sites | SgfI-RsrII |
| ACCN | NM_013476 |
| Insert Size | 2700 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_013476.3, NP_038504.1 |
| RefSeq Size | 2999 bp |
| RefSeq ORF | 2700 bp |
| Locus ID | 11835 |
| UniProt ID | P19091 |
| Gene Summary | This gene encodes a nuclear hormone receptor containing zinc finger and DNA-binding domains. The encoded protein is a key regulator of signalling by androgens, a class of steroid hormones involved in male reproductive development. The protein responds to hormone signalling by translocating to the nucleus, forming dimers, and binding to androgen response elements (AREs) in the promoters of target genes, which are subsequently transcriptionally activated. Activity of this protein is negatively regulated by nuclear receptor subfamily 0 group B member 1 (Nr0b1, also known as Dax1). Mutations in this gene result in feminized genitals and infertility in male animals. Loss of function in female animals also causes problems in reproductive development and function. [provided by RefSeq, May 2015] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG226737 | Ar (tGFP-tagged) - Mouse androgen receptor (Ar), (10ug) |
CNY 7,890.00 |
|
| MR226737 | Ar (Myc-DDK-tagged) - Mouse androgen receptor (Ar) |
CNY 6,584.00 |
|
| MR226737L3 | Lenti ORF clone of Ar (Myc-DDK-tagged) - Mouse androgen receptor (Ar) |
CNY 9,030.00 |
|
| MR226737L4 | Lenti ORF clone of Ar (mGFP-tagged) - Mouse androgen receptor (Ar) |
CNY 9,030.00 |
