Spink2 (NM_001289767) Mouse Untagged Clone
CAT#: MC225486
Spink2 (untagged) - Mouse serine peptidase inhibitor, Kazal type 2 (Spink2), transcript variant 3
CNY 1,200.00
CNY 2,000.00
货期*
现货
规格
Product images
经常一起买 (4)
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 1700007F22Rik; AV038945; HUSI-II |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC225486 representing NM_001289767
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGAAGAGGTCACAGTTCCGAACACCAGACTGTGGTCATTTTGACTTCCCAGCATGCCCTAGGAACCTCA ACCCTGTGTGCGGAACGGATATGAACACTTACAGCAATGAATGTACCCTGTGCATGAAAATCAGGGAGGA CGGTAGCCATATTAATATCATCAAAGACGAGCCATGCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001289767 |
Insert Size | 180 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001289767.1, NP_001276696.1 |
RefSeq Size | 649 bp |
RefSeq ORF | 180 bp |
Locus ID | 69982 |
UniProt ID | Q8BMY7 |
Gene Summary | As a strong inhibitor of acrosin, it is required for normal spermiogenesis. It probably hinders premature activation of proacrosin and other proteases, thus preventing the cascade of events leading to spermiogenesis defects (PubMed:21705336, PubMed:28554943). May be involved in the regulation of serine protease-dependent germ cell apoptosis (PubMed:21705336). It also inhibits trypsin (PubMed:21705336).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (3) differs in the 5' UTR, lacks a portion of the 5' coding region and initiates translation at a downstream start codon, compared to variant 1. It encodes isoform 3, which is shorter at the N-terminus, compared to isoform 1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MR227697 | Spink2 (myc-DDK-tagged) - Mouse serine peptidase inhibitor, Kazal type 2 (Spink2), transcript variant 3 |
CNY 1,900.00 |
Customer
Reviews
Loading...