Cib1 (NM_001291276) Mouse Untagged Clone
CAT#: MC225888
Cib1 (untagged) - Mouse calcium and integrin binding 1 (calmyrin) (Cib1), transcript variant 3
CNY 2,000.00
货期*
3周
规格
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
经常一起买 (3)
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | Cibkip; Kip; Prkdcip |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC225888 representing NM_001291276
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGGAGGTTCGGGCAGTCGCCTGTCTAAGGAGCTGCTGGCCGAGTACCAGGCTAACCCTTTCAAGGAGC GAATCTGCATGGTCTTCTCCACATCACCTACCAGAGACAGCCTGAGCTTTGAGGACTTCCTGGACCTCCT GAGTGTCTTCAGTGACACAGCAACCCCAGACATCAAGTCACACTATGCCTTCCGCATCTTTGACTTTGAT GACGATGGAACCCTGGACAGAGAAGACCTGAGCCAGCTTGTGAATTGCCTCACGGGAGAGGGCGAGGACA CTCGGCTCAGTGCTTCTGAGATGAAGCAGCTGATTGACAATATCCTGGAAGAGTCAGACATTGACAGGGA TGGGACCATCAATCTTTCCGAGTTCCAGCATGTCATCTCGCGCTCACCAGACTTTGCCAGCTCCTTTAAG ATTGTCCTGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001291276 |
Insert Size | 432 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001291276.1, NP_001278205.1 |
RefSeq Size | 911 bp |
RefSeq ORF | 432 bp |
Locus ID | 23991 |
UniProt ID | Q9Z0F4 |
Gene Summary | Calcium-binding protein that plays a role in the regulation of numerous cellular processes, such as cell differentiation, cell division, cell proliferation, cell migration, thrombosis, angiogenesis, cardiac hypertrophy and apoptosis. Involved in bone marrow megakaryocyte differentiation by negatively regulating thrombopoietin-mediated signaling pathway. Participates in the endomitotic cell cycle of megakaryocyte, a form of mitosis in which both karyokinesis and cytokinesis are interrupted. Plays a role in integrin signaling by negatively regulating alpha-IIb/beta3 activation in thrombin-stimulated megakaryocytes preventing platelet aggregation. Up-regulates PTK2/FAK1 activity, and is also needed for the recruitment of PTK2/FAK1 to focal adhesions; it thus appears to play an important role in focal adhesion formation. Positively regulates cell migration on fibronectin in a CDC42-dependent manner, the effect being negatively regulated by PAK1. Functions as a negative regulator of stress activated MAP kinase (MAPK) signaling pathways. Down-regulates inositol 1,4,5-trisphosphate receptor-dependent calcium signaling. Involved in sphingosine kinase SPHK1 translocation to the plasma membrane in a N-myristoylation-dependent manner preventing TNF-alpha-induced apoptosis. Regulates serine/threonine-protein kinase PLK3 activity for proper completion of cell division progression. Plays a role in microtubule (MT) dynamics during neuronal development; disrupts the MT depolymerization activity of STMN2 attenuating NGF-induced neurite outgrowth and the MT reorganization at the edge of lamellipodia. Promotes cardiomyocyte hypertrophy via activation of the calcineurin/NFAT signaling pathway. Stimulates calcineurin PPP3R1 activity by mediating its anchoring to the sarcolemma. In ischemia-induced (pathological or adaptive) angiogenesis, stimulates endothelial cell proliferation, migration and microvessel formation by activating the PAK1 and ERK1/ERK2 signaling pathway. Promotes also cancer cell survival and proliferation. May regulate cell cycle and differentiation of spermatogenic germ cells, and/or differentiation of supporting Sertoli cells.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (3) lacks an alternate in-frame segment compared to variant 1. The resulting isoform (3) has the same N- and C-termini but is shorter compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MR228099 | Cib1 (myc-DDK-tagged) - Mouse calcium and integrin binding 1 (calmyrin) (Cib1), transcript variant 3 |
CNY 1,900.00 |
Customer
Reviews
Loading...