Il15 (NM_001254747) Mouse Untagged Clone

CAT#: MC226014

Il15 (untagged) - Mouse interleukin 15 (Il15), transcript variant 2



  "NM_001254747" in other vectors (1)

CNY 2,000.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms AI503618; IL-15
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226014 representing NM_001254747
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAAAATTTTGAAACCATATATGAGGAATACATCCATCTCGTGCTACTTGTGTTTCCTTCTAAACAGTC
ACTTTTTAACTGAGGCTGGCATTCATGTCTTCATTTTGGGCTGTGTCAGTGTAGGTCTCCCTAAAACAGA
GGCCAACTGGATAGATGTAAGATATGACCTGGAGAAAATTGAAAGCCTTATTCAATCTATTCATATTGAC
ACCACTTTATACACTGACAGTGACTTTCATCCCAGTTGCAAAGTTACTGCAATGAACTGCTTTCTCCTGG
AATTGCAGGTTATTTTACATGAGTACAGTAACATGACTCTTAATGAAACAGTAAGAAACGTGCTCTACCT
TGCAAACAGCACTCTGTCTTCTAACAAGAATGTAGCAGAATCTGGCTGCAAGGAATGTGAGGAGCTGGAG
GAGAAAACCTTCACAGAGTTTTTGCAAAGCTTTATACGCATTGTCCAAATGTTCATCAACACGTCCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001254747
Insert Size 489 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001254747.1, NP_001241676.1
RefSeq Size 1287 bp
RefSeq ORF 489 bp
Locus ID 16168
UniProt ID P48346
Gene Summary This gene encodes a a pleiotropic cytokine of the interleukin family of proteins that plays important roles in the innate and adaptive cell homeostasis, as well as peripheral immune function. The encoded protein undergoes proteolytic processing to generate a mature cytokine that stimulates the proliferation of natural killer cells. The transgenic mice overexpressing the encoded protein exhibit an increase in the number of memory CD8+ T cells in a naive state and enhanced protection against bacterial infections. Mice lacking the encoded protein exhibit impaired protection against a strain of attenuated Mycobacterium. [provided by RefSeq, Aug 2016]
Transcript Variant: This variant (2) uses an alternate splice site in the 5' UTR, compared to variant 1. Variants 1 and 2 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...