Rgs19 (NM_001291208) Mouse Untagged Clone

CAT#: MC226211

Rgs19 (untagged) - Mouse regulator of G-protein signaling 19 (Rgs19), transcript variant 5



  "NM_001291208" in other vectors (1)

CNY 2,000.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 2610042F04Rik; AI324841; AW547781; GAIP
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226211 representing NM_001291208
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTCCAGCCATGACGCAGCCCCCTCAGGACCTCCCAGTCGCAATCCCTGCTGCTTATGCTGGTGCTGCT
GCTGTAGCTGCTCCTGGAACCAAGAACGGCAACGAGCTTGGCAGGTTTCTCGGGAAAGCAAGCTGCAACC
CCTCCCCAGCTGTGAAGTCTGCACTCCACCAAGCCCTAAGGAAGTACAGAGCTGGGCACAGTCCTTTGAC
AAGTTGATGCATAGCCCCACGGGCCGCAGTGTATTCCGGGCATTCCTGCGCACAGAATACAGCGAAGAGA
ACATGCTCTTCTGGCTGGCTTGTGAGGAGTTGAAAGCAGAGGCCAACCAACATGTGGTGGACGAGAAGGC
GCGACTTATCTATGAGGACTACGTGTCCATCCTGTCCCCCAAGGAGGTAAGCCTGGACTCCCGTGTGCGA
GAAGGCATCAATAGGAAGATGCAAGAGCCATCGCCACACACATTTGATGATGCACAGCTGCAGATCTACA
CCCTCATGCACCGGGACTCGTACCCTCGATTCCTTACCTCCCCCACCTACCGCTCTCTATTACTCCAGGG
GGCCCCACAGTCCTCTGAGGCCTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001291208
Insert Size 585 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001291208.1, NP_001278137.1
RefSeq Size 1757 bp
RefSeq ORF 585 bp
Locus ID 56470
Gene Summary Inhibits signal transduction by increasing the GTPase activity of G protein alpha subunits thereby driving them into their inactive GDP-bound form. Binds to G-alpha subfamily 1 members, with the order G(i)a3 > G(i)a1 > G(o)a >> G(z)a/G(i)a2. Activity on G(z)-alpha is inhibited by phosphorylation and palmitoylation of the G-protein (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (5) contains an alternate 5' terminal exon and lacks an internal exon, and it thus differs in the 5' UTR and initiates translation at a downstream in-frame start codon, compared to variant 1. The encoded isoform (c) is shorter at the N-terminus, compared to isoform a. Both variants 4 and 5 encode isoform c. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...