Tpm3 (NM_001253740) Mouse Untagged Clone

CAT#: MC226560

Tpm3 (untagged) - Mouse tropomyosin 3, gamma (Tpm3), transcript variant Tpm3.2



  "NM_001253740" in other vectors (1)

CNY 2,380.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms gamma-TM; hTM30nm; hTMnm; Tm5NM; TM30nm; TMnm; Tpm-5; Tpm5; Trop-5
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226560 representing NM_001253740
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCCGGGACCACCACCATCGAGGCGGTAAAGCGCAAGATCCAGGTTCTGCAGCAGCAAGCTGATGATG
CGGAGGAAAGGGCCGAGCGCCTCCAGCGGGAAGTGGAGGGAGAAAGGCGGGCCCGGGAGCAGGCTGAAGC
TGAGGTGGCCTCCTTGAACCGCAGGATCCAGCTGGTTGAAGAGGAGCTGGACCGTGCGCAGGAGCGCCTT
GCCACTGCTTTGCAGAAGCTGGAGGAAGCAGAGAAGGCTGCTGATGAGAGTGAGAGAGGTATGAAGGTGA
TTGAAAATCGGGCTCTAAAAGATGAAGAAAAGATGGAACTCCAGGAAATCCAGCTAAAGGAAGCAAAGCA
CATTGCAGAAGAGGCCGATAGGAAGTATGAAGAGGTGGCTCGTAAGTTGGTGATTATTGAAGGAGACTTG
GAACGCACGGAGGAACGTGCTGAGCTGGCAGAGTCTAAGTGTTCTGAGCTGGAGGAGGAGCTGAAGAATG
TCACCAACAACCTCAAGTCTCTTGAGGCTCAGGCGGAGAAGTACTCTCAAAAAGAAGACAAGTATGAAGA
AGAAATAAAGATTCTTACTGATAAACTCAAGGAGGCAGAGACCCGTGCTGAGTTTGCTGAAAGATCGGTA
GCCAAGCTGGAGAAGACCATTGATGACCTGGAAGATAAACTGAAGTGCACCAAAGAGGAGCATCTCTGTA
CACAAAGGATGCTGGACCAGACCCTGCTGGACCTGAACGAGATGTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001253740
Insert Size 747 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001253740.1, NP_001240669.1
RefSeq Size 2256 bp
RefSeq ORF 747 bp
Locus ID 59069
Gene Summary Binds to actin filaments in muscle and non-muscle cells. Plays a central role, in association with the troponin complex, in the calcium dependent regulation of vertebrate striated muscle contraction. Smooth muscle contraction is regulated by interaction with caldesmon. In non-muscle cells is implicated in stabilizing cytoskeleton actin filaments.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (4, also known as variant Tpm3.2) represents the use of an alternate promoter and has multiple differences compared to variant Tpm3.13. These differences result in a different 5' UTR and cause translation initiation at an alternate start codon compared to variant Tpm3.13. The encoded isoform (Tpm3.2cy, also known as isoform 4) has a distinct N-terminus and is shorter than isoform Tpm3.13cy. Isoforms Tpm3.1cy, Tpm3.2cy, and Tpm3.5cy are the same length, but contain distinct C-termini.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...