Gjb6 (NM_001271663) Mouse Untagged Clone

CAT#: MC226645

Gjb6 (untagged) - Mouse gap junction protein, beta 6 (Gjb6), transcript variant 3



  "NM_001271663" in other vectors (1)

CNY 2,660.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
GJB6 Antibody - C-terminal region
    • 50 ug

CNY 4,628.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms AA958971; Cx30; D14Bwg0506e
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226645 representing NM_001271663
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGACTGGGGGACCCTGCACACCGTCATCGGTGGCGTGAACAAGCACTCTACCAGCATAGGGAAGGTGT
GGATCACGGTCATCTTTATTTTCCGAGTCATGATCCTAGTGGTGGCTGCCCAGGAAGTGTGGGGTGATGA
GCAGGAGGACTTTGTCTGCAACACTCTGCAGCCAGGGTGCAAGAACGTCTGCTATGACCATTTCTTCCCG
GTGTCTCACATCCGGCTCTGGGCCCTGCAGCTGATCTTTGTGTCTACCCCAGCCCTGTTGGTGGCCATGC
ACGTGGCCTACTACAGACATGAAACTGCCCGAAAGTTTATACGTGGGGAGAAGAGAAACGAGTTTAAAGA
CCTGGAGGACATCAAACGGCAGAAGGTGCGCATTGAGGGCTCCCTGTGGTGGACGTACACCAGCAGCATT
TTCTTCCGCATCATCTTCGAAGCCGCCTTCATGTATGTGTTCTACTTCCTCTACAATGGGTACCACCTAC
CCTGGGTACTGAAATGTGGCATTGACCCCTGCCCCAATCTCGTGGACTGCTTCATTTCGAGGCCAACTGA
GAAAACGGTGTTCACTGTTTTTATGATTTCCGCATCCGTGATTTGCATGCTGCTCAATGTGGCCGAGTTG
TGTTACCTGCTGCTTAAATTGTGCTTTAGGAGATCCAAAAGAACACAGGCGCAGAGAAACCACCCCAACC
ATGCCCTGAAAGAGAGCAAGCAGAATGAAATGAATGAGCTGATCTCAGATAGTGGCCAGAATGCAATCAC
AAGTTTCCCAAGTTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001271663
Insert Size 786 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001271663.1, NP_001258592.1
RefSeq Size 2198 bp
RefSeq ORF 786 bp
Locus ID 14623
UniProt ID P70689
Gene Summary One gap junction consists of a cluster of closely packed pairs of transmembrane channels, the connexons, through which materials of low MW diffuse from one cell to a neighboring cell.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) uses an alternate splice site in the 5' UTR compared to variant 2. Both variants 2 and 3 encode the same protein. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...