Kcnab1 (NM_001289450) Mouse Untagged Clone

CAT#: MC226865

Kcnab1 (untagged) - Mouse potassium voltage-gated channel, shaker-related subfamily, beta member 1 (Kcnab1), transcript variant 2



  "NM_001289450" in other vectors (1)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms Akr8a8; Kvbeta1.1; mKv(beta)1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226865 representing NM_001289450
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGACAATTGCCTACGAAAGTGGAGTTAATCTCTTCGACACAGCTGAGGTCTATGCTGCTGGGAAGGCTG
AGGTGATTCTGGGAAGCATCATCAAGAAGAAAGGCTGGAGGAGGTCCAGCTTGGTCATCACAACCAAACT
CTACTGGGGTGGAAAAGCTGAGACAGAAAGGGGACTGTCAAGAAAGCACATCATTGAAGGACTGAAAGGC
TCCCTCCAGAGGCTGCAACTGGAATACGTGGATGTGGTCTTTGCAAATCGCCCAGACAGCAACACTCCCA
TGGAAGAAATCGTTCGAGCCATGACGCACGTGATCAACCAAGGCATGGCCATGTACTGGGGCACCTCGAG
GTGGAGCGCGATGGAGATCATGGAAGCCTACTCTGTCGCACGGCAGTTCAACATGATCCCGCCTGTCTGT
GAGCAAGCTGAGTACCATCTTTTCCAGAGAGAGAAGGTGGAGGTCCAGCTGCCGGAGCTCTACCATAAAA
TAGGAGTTGGTGCAATGACATGGTCTCCACTTGCTTGTGGAATTATTTCAGGAAAATATGGAAATGGGGT
GCCAGAAAGTTCTAGAGCTTCACTGAAGTGCTACCAGTGGTTGAAGGAAAGAATCGTAAGTGAAGAAGGG
AGAAAACAGCAAAACAAGCTGAAAGACCTCTCTCCAATCGCTGAGCGCCTGGGGTGCACGCTACCTCAGC
TGGCTGTGGCGTGGTGCCTGAGAAATGAGGGTGTGAGTTCTGTGCTCCTGGGATCATCCACTCCGGAACA
ACTCATTGAAAACCTTGGTGCCATTCAGGTCCTCCCTAAGATGACATCTCACGTGGTGAACGAGATTGAT
AACATACTGCGCAACAAGCCCTACAGCAAAAAGGACTATAGATCATAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001289450
Insert Size 888 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001289450.1, NP_001276379.1
RefSeq Size 2851 bp
RefSeq ORF 888 bp
Locus ID 16497
Gene Summary Cytoplasmic potassium channel subunit that modulates the characteristics of the channel-forming alpha-subunits (PubMed:10454353). Modulates action potentials via its effect on the pore-forming alpha subunits (PubMed:10454353). Promotes expression of the pore-forming alpha subunits at the cell membrane, and thereby increases channel activity (PubMed:8824288). Mediates closure of delayed rectifier potassium channels by physically obstructing the pore via its N-terminal domain and increases the speed of channel closure for other family members (By similarity). Promotes the closure of KCNA1, KCNA2 and KCNA5 channels (By similarity). Accelerates KCNA4 channel closure (By similarity). Accelerates the closure of heteromeric channels formed by KCNA1 and KCNA4 (By similarity). Accelerates the closure of heteromeric channels formed by KCNA2, KCNA5 and KCNA6 (By similarity). Enhances KCNB1 and KCNB2 channel activity (PubMed:8824288). Binds NADPH; this is required for efficient down-regulation of potassium channel activity (By similarity). Has NADPH-dependent aldoketoreductase activity (By similarity). Oxidation of the bound NADPH strongly decreases N-type inactivation of potassium channel activity (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) differs in the 5' UTR and coding sequence compared to variant 1. The resulting isoform (2) is shorter at the N-terminus compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...