Tex264 (NM_001081654) Mouse Untagged Clone

CAT#: MC226937

Tex264 (untagged) - Mouse testis expressed gene 264 (Tex264), transcript variant 2



  "NM_001081654" in other vectors (1)

CNY 3,040.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms TEG-264
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226937 representing NM_001081654
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCCGGATCTCCTACTACTGGGCCTGATTGGGGCCCTGACGCTGCTGTTGCTGCTGACGCTGCTGGCCT
TTGCTGGTTATTCAGGACTGCTGACTGGGGTGACAGTGAGCGCTGGATCACCCCCAATCCGCAACATAAC
TGTGGCCTACAAGTTCCACGTGGGGTCCTATGGTGACACTGGGCACCTTTTCACAGAGAGCTGCAGCATC
TCTCCCAAGCTCCGTTCCATCGCTGTCTACTATGACAACCCCCATACGGTGCCTCCTGAGAAGTGCCGCT
GTGCAGTCGGCAGCATCCTGAGTGAGGGGGAGGAGTCGCCTTCACCTGAGCTCATCCACCTCTATCAGAA
ATTTGGCTTCAAGATATTCTCCTTCCCAGCACCTAGCCATGTGGTCATAGCTACCTTCCCTTACACCACC
CCCATATCCATCTGGCTGGCTGCCCGCCGAGTCCATCCTGCCTTGGATACCTACATCAAGGAGCGGAAGC
TGTGTGCTCACCCTCGCCTGGAGATCTACCATCAAGACAAGATCCATTTCATGTGCCCACTGGCAAGGCA
AGGAGATTTCTACGTGCCAGAGGTGAAGGAGACAGAGCGGAAATGCCGGGAGCTTGCGGAGGCCACTGAC
ACCCAGACGGATGGCACAGGAGCTGATACAAGTGATGCAAGTTCTGTGAGCCTGGATGTTCGCCCTGGCA
GCCGGGAGACTTCAGCCACCACACTTTCTCCTGGGGCAGGCAACCGTGGCTGGGACGACGGTGACAACCG
CAGCGAGCACAGCTACAGTGAATCGGGTGCCAGTGGCTCATCCTTTGAGGAGCTGGACCTGGAGGGCGAG
GGACCCTTGGGAGAACCCCGACTGAACCCTGAAGCCAAGCTTCTGGGGCCCCCTCGGGAGCTCAGCACCC
CTGAGAGGGGTGAGGAGTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001081654
Insert Size 930 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001081654.2, NP_001075123.1
RefSeq Size 1451 bp
RefSeq ORF 930 bp
Locus ID 21767
UniProt ID E9Q137
Gene Summary Major reticulophagy (also called ER-phagy) receptor that acts independently of other candidate reticulophagy receptors to remodel subdomains of the endoplasmic reticulum into autophagosomes upon nutrient stress, which then fuse with lysosomes for endoplasmic reticulum turnover. The ATG8-containing isolation membrane (IM) cradles a tubular segment of TEX264-positive ER near a three-way junction, allowing the formation of a synapse of 2 juxtaposed membranes with trans interaction between the TEX264 and ATG8 proteins. Expansion of the IM would extend the capture of ER, possibly through a 'zipper-like' process involving continued trans TEX264-ATG8 interactions, until poorly understood mechanisms lead to the fission of relevant membranes and, ultimately, autophagosomal membrane closure. Also involved in the repair of covalent DNA-protein cross-links (DPCs) during DNA synthesis: acts by bridging VCP/p97 to covalent DNA-protein cross-links (DPCs) and initiating resolution of DPCs by SPRTN.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) differs in the 5' UTR, compared to variant 1. Variants 1, 2, and 3 encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...