Arntl2 (NM_001289681) Mouse Untagged Clone

CAT#: MC227245

Arntl2 (untagged) - Mouse aryl hydrocarbon receptor nuclear translocator-like 2 (Arntl2), transcript variant 4



  "NM_001289681" in other vectors (1)

CNY 3,420.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit Polyclonal Anti-Arntl2 Antibody
    • 50 ug

CNY 5,250.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 4632430A05Rik; bHLHe6; BMAL2; CLIF; MOP9
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC227245 representing NM_001289681
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAAGAGCTGTACCGTCCCTGTCAAAGAAGAGCAGCCATGCTCGTCCTGCTCAAAGAAGAAAGACCATA
GAAAATTCCACACCGTCCATTGCACTGGATACTTGAGAAGCTGGCCTCTGAATGTTGTTGGCATGGAGAA
AGAGTCGGGTGGTGGGAAGGACAGCGGTCCTCTTACCTGCCTTGTGGCTATGGGACGGTTGCATCCATAC
ATTGTCCCTCAAAAGAGTGGCAAGATCAACGTGAGACCGGCTGAGTTCATAACTCGCTTCGCAATGAACG
GGAAATTCGTCTATGTTGACCAAAGGGCAACGGCAATTTTAGGATACCTGCCTCAGGAACTTTTGGGAAC
TTCATGTTATGAATATTTTCATCAGGATGACCACAGTAGTTTGACTGACAAGCACAAAGCAGTTCTGCAG
AGTAAGGAGAAAATACTTACAGACTCATACAAATTCAGAGTGAAGGATGGTGCCTTCGTGACTCTGAAGA
GTGAGTGGTTCAGCTTCACAAACCCTTGGACCAAAGAGCTGGAGTACATTGTGTCTGTCAACACATTGGT
TTTGGGGCGCAGTGAGACCAGGCTGTCTTTGCTTCATTGCGGCGGCAGCAGCCAGTCCTCCGAAGACTCA
TTTAGACAATCCTGCATCAATGTGCCCGGTGTATCCACGGGGACCGTCCTTGGTGCTGGGAGTATTGGAA
CAGATATTGCAAATGAGGTTCTGAGTTTACAGAGATTACACTCTTCATCCCCAGAAGATGCAAGCCCTTC
AGAAGAAGTGAGAGATGACTGCAGTGTAAATGGTGGGAATGCCTATGGGCCTGCATCCACTAGGGAGCCT
TTTGCAGTGAGCCCTTCTGAAACAGAGGTCCTGGAGGCTGCCAGGCAACACCAGAGCACTGAACCCGCCC
ACCCTCACGGACCACTTCCCGGTGACAGTGCCCAGCTGGGTTTTGATGTCCTGTGTGACAGTGACAGCAT
AGACATGGCTGCATTCATGAATTACCTCGAAGCAGAGGGGGGCCTGGGTGACCCTGGGGACTTCAGTGAC
ATCCAGTGGGCACTCTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001289681
Insert Size 1068 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001289681.1, NP_001276610.1
RefSeq Size 2547 bp
RefSeq ORF 1068 bp
Locus ID 272322
UniProt ID Q2VPD4
Gene Summary This gene encodes a basic helix-loop-helix transcription factor belonging to the PAS (Per, Arnt, Sim) superfamily. The PAS proteins play important roles in adaptation to low atmospheric and cellular oxygen levels, exposure to certain environmental pollutants, and diurnal oscillations in light and temperature. This protein forms a transcriptionally active heterodimer with the circadian Clock protein, the structurally related Mop4, and hypoxia-inducible factors, such as Hif1alpha. Consistent with its role as a biologically relevant partner of circadian and hypoxia factors, this protein is coexpressed in regions of the brain such as the thalamus, hypothalamus, and amygdala. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Feb 2014]
Transcript Variant: This variant (4) uses an alternate splice site in the 5' region and initiates translation at a downstream in-frame start codon, compared to variant 1. The encoded isoform (4) has a shorter N-terminus than isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...