Ager (NM_001271423) Mouse Untagged Clone

CAT#: MC227423

Ager (untagged) - Mouse advanced glycosylation end product-specific receptor (Ager), transcript variant 3



  "NM_001271423" in other vectors (1)

CNY 3,710.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms RAGE
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC227423 representing NM_001271423
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCCAGCGGGGACAGCAGCTAGAGCCTGGGTGCTGGTTCTTGCTCTATGGGGAGCTGTAGCTGGTGGTC
AGAACATCACAGCCCGGATTGGAGAGCCACTTGTGCTAAGCTGTAAGGGGGCCCCTAAGAAGCCGCCCCA
GCAGCTAGAATGGAAACTGGTCCTCTCTCCCCAGGGAGGCCCCTGGGACAGCGTGGCTCGAATCCTCCCC
AATGGTTCCCTCCTCCTTCCAGCCACTGGAATTGTCGATGAGGGGACTTTCCGGTGTCGGGCAACTAACA
GGCGAGGGAAGGAGGTCAAGTCCAACTACCGAGTCCGAGTCTACCAGATTCCTGGGAAGCCAGAAATTGT
GGATCCTGCCTCTGAACTCACAGCCAGTGTCCCTAATAAGGTGGGGACATGTGTGTCTGAGGGAAGCTAC
CCTGCAGGGACCCTTAGCTGGCACTTAGATGGGAAACTTCTGATTCCCGATGGCAAAGAAACACTCGTGA
AGGAAGAGACCAGGAGACACCCTGAGACGGGACTCTTTACACTGCGGTCAGAGCTGACAGTGATCCCCAC
CCAAGGAGGAACCCATCCTACCTTCTCCTGCAGTTTCAGCCTGGGCCTTCCCCGGCGCAGACCCCTGAAC
ACAGCCCCCATCCAACTCCGAGTCAGGGAGCCTGGGCCTCCAGAGGGCATTCAGCTGTTGGTTGAGCCTG
AAGGTGGAATAGTCGCTCCTGGTGGGACTGTGACCTTGACCTGTGCCATCTCTGCCCAGCCCCCTCCTCA
GGTCCACTGGATAAAGGATGGTGCACCCTTGCCCCTGGCTCCCAGCCCTGTGCTGCTCCTCCCTGAGGTG
GGGCACGAGGATGAGGGCACCTATAGCTGCGTGGCCACCCACCCTAGCCACGGACCTCAGGAAAGCCCTC
CTGTCAGCATCAGGGTCACAGGCTCTGTGGGTGAGTCTGGGCTGGGTACGCTAGCCCTGGCCTTGGGGAT
CCTGGGAGGCCTGGGAGTAGTAGCCCTGCTCGTCGGGGCTATCCTGTGGCGAAAACGACAACCCAGGCGT
GAGGAGAGGAAGGCCCCGGAAAGCCAGGAGGATGAGGAGGAACGTGCAGAGCTGAATCAGTCAGAGGAAG
CGGAGATGCCAGAGAATGGTGCCGGGGGACCGTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001271423
Insert Size 1155 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001271423.1, NP_001258352.1
RefSeq Size 1333 bp
RefSeq ORF 1155 bp
Locus ID 11596
UniProt ID Q62151
Gene Summary Mediates interactions of advanced glycosylation end products (AGE). These are nonenzymatically glycosylated proteins which accumulate in vascular tissue in aging and at an accelerated rate in diabetes. Acts as a mediator of both acute and chronic vascular inflammation in conditions such as atherosclerosis and in particular as a complication of diabetes. AGE/RAGE signaling plays an important role in regulating the production/expression of TNF-alpha, oxidative stress, and endothelial dysfunction in type 2 diabetes. Interaction with S100A12 on endothelium, mononuclear phagocytes, and lymphocytes triggers cellular activation, with generation of key proinflammatory mediators. Interaction with S100B after myocardial infarction may play a role in myocyte apoptosis by activating ERK1/2 and p53/TP53 signaling. Can also bind oligonucleotides. Receptor for amyloid beta peptide. Contributes to the translocation of amyloid-beta peptide (ABPP) across the cell membrane from the extracellular to the intracellular space in cortical neurons. ABPP-initiated RAGE signaling, especially stimulation of p38 mitogen-activated protein kinase (MAPK), has the capacity to drive a transport system delivering ABPP as a complex with RAGE to the intraneuronal space. RAGE-dependent signaling in microglia contributes to neuroinflammation, amyloid accumulation, and impaired learning/memory in a mouse model of Alzheimer disease.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) uses an alternate in-frame splice site and lacks an in-frame exon, compared to variant 1. The encoded isoform (c) is shorter than isoform a. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...