Relb (NM_001290457) Mouse Untagged Clone

CAT#: MC228286

Relb (untagged) - Mouse avian reticuloendotheliosis viral (v-rel) oncogene related B (Relb), transcript variant 2



  "NM_001290457" in other vectors (1)

CNY 5,420.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
RELB Antibody - N-terminal region
    • 50 ug

CNY 4,381.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms shep
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC228286 representing NM_001290457
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCCGAGTCGCCGCGCTGCCAGAGAGTCCGCGCCCGAGCTAGGGGCCTTGGGTTCCAGTGACCTCTCTT
CCCTGTCACTAACGGTCTCCAGGACCACAGAAATCATCGACGAATACATTAAGGAGAACGGCTTTGGCCT
GGACGGGACACAGCTGAGTGAGATGCCGCGCCTGGTGCCCCGCGGGCCCGCCTCACTGAGCAGCGTCACG
CTGGGCCCTGCTGCACCACCGCCTCCGGCCACGCCGTCCTGGAGCTGCACACTGGGCAGGCTGGTGTCAC
CCGGCCCGTGCCCACGGCCGTACCTGGTCATCACAGAGCAGCCAAAGCAGCGTGGCATGCGCTTCCGCTA
CGAGTGCGAGGGCCGCTCGGCCGGCAGCATCCTCGGGGAGAGCAGCACCGAAGCCAGCAAGACCCTGCCC
GCCATCGAGCTTCGAGACTGTGGCGGGCTGCGGGAGGTGGAGGTGACGGCGTGCCTGGTGTGGAAGGACT
GGCCACACCGGGTACACCCACATAGCCTCGTGGGGAAAGACTGCACGGACGGCGTCTGCAGGGTGCGGCT
GCGGCCTCACGTCAGCCCCCGGCACAGCTTTAACAACCTGGGCATCCAGTGTGTTAGGAAGAAGGAAATT
GAAGCTGCCATTGAGCGGAAGATCCAGCTGGGAATTGACCCCTACAATGCTGGCTCCCTGAAGAACCATC
AGGAGGTCGACATGAATGTCGTCAGGATCTGCTTCCAGGCCTCCTATCGGGACCAGCAGGGACATCTGCA
CCGCATGGACCCCATCCTCTCTGAGCCTGTCTACGACAAGAAGTCCACCAACACATCGGAGCTGCGGATT
TGCCGAATCAACAAGGAGAGCGGGCCGTGCACAGGTGGTGAGGAGCTGTACTTGCTCTGTGACAAGGTGC
AAAAAGAGGACATATCCGTGGTGTTCAGCACAGCTTCCTGGGAAGGCCGTGCCGACTTCTCTCAAGCTGA
TGTGCACCGGCAGATCGCCATTGTGTTCAAAACGCCACCCTACGAGGACCTGGAGATCTCAGAGCCCGTG
ACTGTCAATGTGTTCTTGCAGCGGCTCACGGATGGGGTGTGCAGCGAGCCGCTGCCCTTCACGTACCTGC
CTCGGGATCATGACAGCTACGGTGTGGACAAGAAGCGAAAGCGGGGACTGCCTGATGTCCTTGGAGAGTT
GAGCAGCTCTGATCCACATGGAATCGAGAGCAAACGAAGGAAAAAGAAACCAGTGTTCTTGGACCACTTC
CTGCCTGGCCACAGCTCAGGCCTGTTCCTCCCACCATCGGCTCTGCAGCCGGCAGACTCTGATTTCTTCC
CTGCTTCCATATCCCTTCCTGGGCTGGAGCCTCCTGGTGGACCCGATCTCCTGGACGATGGCTTTGCCTA
TGATCCTTCTGCCCCCACGCTCTTCACTATGTTGGACCTGCTGCCCCCAGCACCACCACTTGCCAGTGCT
GTGGTGGGTAGCGGGGGTGCAGGGGCCACCGTTGTGGAGTCTTCTGGCCCAGAGCCCCTATCACTGGACT
CTTTTGCAGCGCCGGGCCCCGGGGATGTTGGTACTGCTAGCCTTGTGGGCAGCAACATGTTTCCCAACCA
GTACCGAGAGGCAGCTTTCGGGGGTGGCCTCCTATCTCCAGGGCCTGAAGCCACGTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001290457
Insert Size 1668 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001290457.1, NP_001277386.1
RefSeq Size 2194 bp
RefSeq ORF 1668 bp
Locus ID 19698
UniProt ID Q04863
Gene Summary NF-kappa-B is a pleiotropic transcription factor which is present in almost all cell types and is involved in many biological processed such as inflammation, immunity, differentiation, cell growth, tumorigenesis and apoptosis. NF-kappa-B is a homo- or heterodimeric complex formed by the Rel-like domain-containing proteins RELA/p65, RELB, NFKB1/p105, NFKB1/p50, REL and NFKB2/p52. The dimers bind at kappa-B sites in the DNA of their target genes and the individual dimers have distinct preferences for different kappa-B sites that they can bind with distinguishable affinity and specificity. Different dimer combinations act as transcriptional activators or repressors, respectively. NF-kappa-B is controlled by various mechanisms of post-translational modification and subcellular compartmentalization as well as by interactions with other cofactors or corepressors. NF-kappa-B complexes are held in the cytoplasm in an inactive state complexed with members of the NF-kappa-B inhibitor (I-kappa-B) family. In a conventional activation pathway, I-kappa-B is phosphorylated by I-kappa-B kinases (IKKs) in response to different activators, subsequently degraded thus liberating the active NF-kappa-B complex which translocates to the nucleus. NF-kappa-B heterodimeric RelB-p50 and RelB-p52 complexes are transcriptional activators. RELB neither associates with DNA nor with RELA/p65 or REL. Stimulates promoter activity in the presence of NFKB2/p49 (By similarity). As a member of the NUPR1/RELB/IER3 survival pathway, may allow the development of pancreatic intraepithelial neoplasias. Regulates the circadian clock by repressing the transcriptional activator activity of the CLOCK-ARNTL/BMAL1 heterodimer in a CRY1/CRY2 independent manner. Increased repression of the heterodimer is seen in the presence of NFKB2/p52. Is required for both T and B lymphocyte maturation and function (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) lacks an alternate in-frame exon compared to variant 1. The resulting isoform (2) has the same N- and C-termini but is shorter compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...