GPR123 (ADGRA1) (NM_001083909) Human Tagged ORF Clone
CAT#: RG223617
- TrueORF®
GPR123 (tGFP-tagged) - Human G protein-coupled receptor 123 (GPR123)
ORF Plasmid: DDK
"NM_001083909" in other vectors (4)
Need custom modification / cloning service?
Get a free quote
CNY 5,420.00
Specifications
Product Data | |
Type | Human Tagged ORF Clone |
Tag | TurboGFP |
Synonyms | GPR123 |
Vector | pCMV6-AC-GFP |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>RG223617 representing NM_001083909
Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGATCTGAAGACAGTGCTCTCCCTGCCCCGCTACCCAGGGGAGTTCCTGCACCCCGTGGTGT ACGCGTACGCGGCCGCTCGAG - GFP Tag - GTTTAA >RG223617 representing NM_001083909
Red=Cloning site Green=Tags(s) MDLKTVLSLPRYPGEFLHPVV TRTRPLE - GFP Tag - V |
Restriction Sites |
SgfI-MluI
Cloning Scheme for this gene
Plasmid Map
![]() |
ACCN | NM_001083909 |
ORF Size | 1680 bp |
OTI Disclaimer | The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This clone was engineered to express the complete ORF with an expression tag. Expression varies depending on the nature of the gene. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001083909.1, NP_001077378.1 |
RefSeq Size | 4298 bp |
RefSeq ORF | 1683 bp |
Locus ID | 84435 |
UniProt ID | Q86SQ6 |
Protein Families | Transmembrane |
Gene Summary | This gene encodes a protein that belongs to the adhesion family of G-protein-coupled receptors. Members of this family function in several sensory systems and regulate blood pressure, immune responses, food intake and development. A similar protein in rodents is thought to play a role in in the regulation of neuronal signaling pathways. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Mar 2014] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC223617 | GPR123 (Myc-DDK-tagged)-Human G protein-coupled receptor 123 (GPR123) |
CNY 4,168.00 |
|
RC223617L3 | Lenti ORF clone of Human G protein-coupled receptor 123 (GPR123), Myc-DDK-tagged |
CNY 6,840.00 |
|
RC223617L4 | Lenti ORF clone of Human G protein-coupled receptor 123 (GPR123), mGFP tagged |
CNY 6,840.00 |
|
SC316063 | GPR123 (untagged)-Human G protein-coupled receptor 123 (GPR123) |
CNY 4,176.00 |