Stn1 (NM_001011943) Rat Untagged Clone

CAT#: RN201073

Obfc1 (untagged ORF) - Rat oligonucleotide/oligosaccharide-binding fold containing 1 (Obfc1), (10 ug)



  "NM_001011943" in other vectors (3)

CNY 3,990.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Synonyms Obfc1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN201073 representing NM_001011943
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCCAGAACCTTGCCTTTTGATGCAGTGCGAATCCAGTCCAAAAGAAGAGGAGATCCCGTCCCTCTTTT
GGGGTCTGGATCCCGTGTTTCTAGCCTTTGCAAAACTCTACATCAAGGACATCCTGGAGATGAAGGAGTC
CCAACAAGTGCCAGGCATGTATTTTTACAATGGACATCCAATAAGACGGGTGGATATCATGGGAGCTGTC
ATCAGTGTGAAAGAGAGAGAGACTTTCTACAGCTATGGAGTGGATGACGCCACAGGGGTTATAAACTGTG
TGTGCTGGAAAAGGCCAAGCAATGCCGAGTCTTCATCAGACCCAGCTATTCTGAGCACTTCGAGAGAACT
CAGCATGACCTCACAGCTTAAGAAACTGCAGGAGACCATTGAGCAGAAAACCAAGATCGGGATTGGGGAT
ATCATCCGAGTCCGAGGCTACGTGCGTATGTTCCGAGAAGAGCGAGAGATCTGTGCCACCATTTATTATA
AGGTGGACGATCCAGTGTGGAACATGCAAATTGCAAGGATGCTTGAGCTGCCAGAGCTCTACAAGAAGGT
GTATGACCAGCCCTTCCGGAACCCAGCCCTAAAGGAGGAAGAGGCACTAAACAGTAAAGACACTTTGGAT
CTCGCTGGCCTCACGGCTTTGTTGAGTGAGAAAGTTAAAGAATTTCTCCAGGAGAAGAAAGTGCAAAGCT
TCTACCAGAAGGAGCTGGAAATGGTGGAGCCCTTGCAGTCTCTGGCCAGTCAGCCCGTGACCCACAGCAC
GTGCTCGGACCAAGTGGAGTTAAAGAACGACGCCGCTTCTGACATACACAGTGTGTTTAAGAATGCTCTG
CACCTGCTTCAGGAAAAGGGGTTCGTGTTCCAGAGAGACGGTGGCTCCGATAAGCTGTACTATGTTACCA
GTAAGGACAAAGACCTGCACCAGAAGATCTACCAGATCATTAAGGAAGACTGTCAGAAACCAAATCTGTG
GTGCATGCTGCCTCAGGAGGCCTGGAGAGGGACTGAGGAAGGCCTGGCCGTCGTGGTCACACTTAGTGTC
TGCCTGCCCTTGCCCGTAGATGTGGAGAAGGGCTGCCACTTGATGCACGTCCTGAACTGCGTGCTCCTCA
ACCTCCGCTGGGACCTGAACAAGGCTGTGCTGCAGCAGGTGCTGGAGCTCCTGGAGGACCAGAGCGACAT
TGTGAGTACTGGAGACCACTACTACACGGCCTTCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001011943
Insert Size 1227 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001011943.1, NP_001011943.1
RefSeq Size 1555 bp
RefSeq ORF 1227 bp
Locus ID 294025
UniProt ID Q6AYD2
Gene Summary Component of the CST complex proposed to act as a specialized replication factor promoting DNA replication under conditions of replication stress or natural replication barriers such as the telomere duplex. The CST complex binds single-stranded DNA with high affinity in a sequence-independent manner, while isolated subunits bind DNA with low affinity by themselves. Initially the CST complex has been proposed to protect telomeres from DNA degradation. However, the CST complex has been shown to be involved in several aspects of telomere replication. The CST complex inhibits telomerase and is involved in telomere length homeostasis; it is proposed to bind to newly telomerase-synthesized 3' overhangs and to terminate telomerase action implicating the association with the ACD:POT1 complex thus interfering with its telomerase stimulation activity. The CST complex is also proposed to be involved in fill-in synthesis of the telomeric C-strand probably implicating recruitment and activation of DNA polymerase alpha. The CST complex facilitates recovery from many forms of exogenous DNA damage; seems to be involved in the re-initiation of DNA replication at repaired forks and/or dormant origins. Required for efficicient replication of the duplex region of the telomere. Promotes efficient replication of lagging-strand telomeres. Promotes general replication start following replication-fork stalling implicating new origin firing. May be in involved in C-strand fill-in during late S/G2 phase independent of its role in telomere duplex replication (By similarity).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...