United States
Germany
Japan
United Kingdom
China
Manf (NM_001108183) Rat Untagged Clone
CAT＃: RN201485
Manf (untagged ORF) - Rat arginine-rich, mutated in early stage tumors (Armet), (10 ug)
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Rat Untagged Clone |
| Tag | Tag Free |
| Synonyms | Armet |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>RN201485 representing NM_001108183
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTGGGCTACGCGCGGGCTGGCGGTAGCGCTGGCCCTGAGCGTTCTGCCTGACAGTCGGGCGCTACGGC CAGGCGACTGCGAAGTTTGTATTTCTTATCTGGGGAGATTTTACCAGGACCTCAAAGACAGGGATGTCAC ATTTTCACCAGCCACTATTGAAGAAGAACTTATAAAGTTCTGCCGGGAAGCAAGAGGCAAAGAAAATCGG TTGTGCTACTACATTGGAGCCACAGATGATGCCGCCACCAAGATCATCAATGAGGTATCGAAGCCTCTGG CCCACCATATCCCTGTGGAGAAGATCTGTGAGAAGCTGAAGAAGAAAGACAGCCAGATCTGCGAGCTAAA ATACGGTGAGTGTGACTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001108183 |
| Insert Size | 369 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001108183.1, NP_001101653.1 |
| RefSeq Size | 550 bp |
| RefSeq ORF | 369 bp |
| Locus ID | 315989 |
| Gene Summary | Selectively promotes the survival of dopaminergic neurons of the ventral mid-brain (By similarity). Modulates GABAergic transmission to the dopaminergic neurons of the substantia nigra (PubMed:16462600). Enhances spontaneous, as well as evoked, GABAergic inhibitory postsynaptic currents in dopaminergic neurons (PubMed:16462600). Inhibits cell proliferation and endoplasmic reticulum (ER) stress-induced cell death (By similarity). Retained in the ER/sarcoplasmic reticulum (SR) through association with the endoplasmic reticulum chaperone protein HSPA5 under normal conditions (By similarity). Up-regulated and secreted by the ER/SR in response to ER stress and hypoxia (By similarity). Following secretion by the ER/SR, directly binds to 3-O-sulfogalactosylceramide, a lipid sulfatide in the outer cell membrane of target cells (By similarity). Sulfatide binding promotes its cellular uptake by endocytosis, and is required for its role in alleviating ER stress and cell toxicity under hypoxic and ER stress conditions (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RR201485 | Manf (Myc-DDK-tagged ORF) - Rat arginine-rich, mutated in early stage tumors (Armet), (10 ug) |
CNY 3,990.00 |
|
| RR201485L3 | Lenti ORF clone of Manf (Myc-DDK-tagged ORF) - Rat arginine-rich, mutated in early stage tumors (Armet), (10 ug) |
CNY 6,080.00 |
|
| RR201485L4 | Lenti ORF clone of Manf (mGFP-tagged ORF) - Rat arginine-rich, mutated in early stage tumors (Armet), (10 ug) |
CNY 6,650.00 |
