Atp5f1e (NM_139099) Rat Untagged Clone
CAT#: RN204682
Atp5e (untagged ORF) - Rat ATP synthase, H+ transporting, mitochondrial F1 complex, epsilon subunit (Atp5e), nuclear gene encoding mitochondrial protein, (10 ug)
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Rat Untagged Clone |
Tag | Tag Free |
Synonyms | Atp5e |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>RN204682 representing NM_139099
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGTGGCGTACTGGCGACAGGCTGGACTCAGCTACATCCGGTTCTCCCAGATCTGTGCAAAAGCAGTGA GGGATGCCCTGAAGACTGAGTTCAAAGCGAACGCTGAGAAGACTTCGGGCACCAGCATAAAAACAGTGAA AATAAAGAAGGAGTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_139099 |
Insert Size | 156 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_139099.1, NP_620799.1 |
RefSeq Size | 404 bp |
RefSeq ORF | 156 bp |
Locus ID | 245958 |
UniProt ID | P29418 |
Gene Summary | human homolog is the epsilon subunit of human ATP synthase [RGD, Feb 2006] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RR204682 | Atp5e (Myc-DDK-tagged ORF) - Rat ATP synthase, H+ transporting, mitochondrial F1 complex, epsilon subunit (Atp5e), nuclear gene encoding mitochondrial protein, (10 ug) |
CNY 3,990.00 |
|
RR204682L3 | Lenti ORF clone of Atp5e (Myc-DDK-tagged ORF) - Rat ATP synthase, H+ transporting, mitochondrial F1 complex, epsilon subunit (Atp5e), nuclear gene encoding mitochondrial protein, (10 ug) |
CNY 6,080.00 |
|
RR204682L4 | Lenti ORF clone of Atp5e (mGFP-tagged ORF) - Rat ATP synthase, H+ transporting, mitochondrial F1 complex, epsilon subunit (Atp5e), nuclear gene encoding mitochondrial protein, (10 ug) |
CNY 6,650.00 |
其它Atp5f1e产品