United States
Germany
Japan
United Kingdom
China
Snx3 (NM_001044283) Rat Untagged Clone
CAT＃: RN207265
Snx3 (untagged ORF) - Rat similar to sorting nexin 3 (LOC684097), (10 ug)
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Rat Untagged Clone |
| Tag | Tag Free |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>RN207265 representing NM_001044283
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCGGAGACCGTAGCGGACACCCGGCGGCTCATCACCAAGCCGCAGAACCTGAATGACGCCTACGGGC CGCCCAGCAACTTCCTCGAGATCGACGTGAGCAATCCGCAGACTGTGGGGGTCGGCCGGGGCCGCTTCAC CACCTACGAGATCAGGGTCAAGACCAATCTTCCTATCTTCAAGCTGAAGGAATCTACTGTTAGAAGAAGA TACAGTGACTTTGAGTGGCTTCGAAGTGAACTAGAGAGAGAGAGCAAGGTTGTCGTTCCCCCACTCCCGG GGAAAGCATTTTTGCGGCAGCTTCCTTTTAGAGGAGACGATGGAATATTTGACGATAATTTCATCGAGGA AAGGAAGCAAGGGCTGGAACAGTTCATAAACAAGGTCGCTGGTCATCCTCTGGCCCAGAATGAACGTTGT CTTCACATGTTTTTACAGGATGAAATCATAGATAAAAGCTATACTCCATCTAAAATAAGACATGCCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001044283 |
| Insert Size | 489 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_001044283.1, NP_001037748.1 |
| RefSeq Size | 1490 bp |
| RefSeq ORF | 489 bp |
| Locus ID | 684097 |
| UniProt ID | Q5U211 |
| Gene Summary | Phosphoinositide-binding protein required for multivesicular body formation. Specifically binds phosphatidylinositol 3-phosphate (PtdIns(P3)). Also can bind phosphatidylinositol 4-phosphate (PtdIns(P4)), phosphatidylinositol 5-phosphate (PtdIns(P5)) and phosphatidylinositol 3,5-biphosphate (PtdIns(3,5)P2). Plays a role in protein transport between cellular compartments. Together with RAB7A facilitates endosome membrane association of the retromer cargo-selective subcomplex (CSC). May act in part as component of the SNX3-retromer complex which mediates the retrograde endosome-to-TGN transport of WLS distinct from the SNX-BAR retromer pathway. Promotes stability and cell surface expression of epithelial sodium channel (ENAC) subunits SCNN1A and SCNN1G. Not involved in EGFR degradation. Involved in the regulation of phagocytosis in dendritic cells possibly by regulating EEA1 recruitment to the nascent phagosomes. Involved in iron homeostasis through regulation of endocytic recycling of the transferrin receptor Tfrc presuambly by delivering the transferrin:transferrin receptor complex to recycling endosomes; the function may involve the CSC retromer subcomplex. Involved in regulation of neurite outgrowth in primary neurons.[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RR207265 | Snx3 (Myc-DDK-tagged ORF) - Rat similar to sorting nexin 3 (LOC684097), (10 ug) |
CNY 3,990.00 |
|
| RR207265L3 | Lenti ORF clone of Snx3 (Myc-DDK-tagged ORF) - Rat similar to sorting nexin 3 (LOC684097), (10 ug) |
CNY 6,080.00 |
|
| RR207265L4 | Lenti ORF clone of Snx3 (mGFP-tagged ORF) - Rat similar to sorting nexin 3 (LOC684097), (10 ug) |
CNY 6,650.00 |
