Hspb6 (NM_138887) Rat Untagged Clone

CAT#: RN207821

Hspb6 (untagged ORF) - Rat heat shock protein, alpha-crystallin-related, B6 (Hspb6), (10 ug)



  "NM_138887" in other vectors (3)

CNY 3,990.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Synonyms Hsp20; p20
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN207821 representing NM_138887
Red=Cloning site Blue=ORF Orange=Stop codon

CTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCCGGCGC
GCC
C

ATGGAGATCCGGGTGCCTGTGCAGCCTTCTTGGCTGCGCCGTGCTTCAGCTCCTTTACCGGGTTTTTCCA
CTCCGGGACGCCTCTTTGACCAGCGTTTCGGCGAAGGGCTGCTTGAGGCAGAGCTGGCTTCACTGTGCCC
TGCTGCGATCGCGCCCTACTATCTGCGCGCCCCCAGTGTGGCGTTACCCACAGCCCAGGTGCCCACGGAC
CCTGGGTATTTTTCTGTGCTGCTGGATGTGAAGCACTTCTCGCCAGAGGAAATCTCTGTCAAGGTGGTTG
GTGACCATGTGGAGGTCCATGCTCGGCATGAGGAGCGCCCAGATGAACATGGATTCATTGCTCGAGAGTT
CCACCGCCGATACCGCCTGCCTCCTGGCGTGGACCCTGCTGCAGTGACCTCTGCACTGTCTCCTGAGGGT
GTTCTGTCTATCCAGGCCACACCAGCGTCGGCCCAGGCCTCACTTCCGTCACCACCTGCTGCCAAGTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites AscI-MluI     
ACCN NM_138887
Insert Size 489 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_138887.1, NP_620242.1
RefSeq Size 1310 bp
RefSeq ORF 489 bp
Locus ID 192245
UniProt ID P97541
Gene Summary may play a role in muscle contraction [RGD, Feb 2006]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...