Uqcc2 (NM_001108528) Rat Untagged Clone
CAT#: RN210575
Mnf1 (untagged ORF) - Rat similar to RIKEN cDNA 2900010M23 (RGD1306917), (10 ug)
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Rat Untagged Clone |
Tag | Tag Free |
Synonyms | M19; Mnf1; RGD1306917 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>RN210575 representing NM_001108528
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCCGCTCTCCGCTACCGGCGTTTTCTTAAGCTCTGTGAGGAATGGCCAGTGGACGAGACCAAACGGG GCCGGGACTTGGGCGCTTACCTGCGGCAGCGGGTAGCACAGGCCTTTCGGGAGGGAGAGAACACCCAGGT TGCAGAACCCGAGGCCTGTGATCAGATGTACGAGAGCTTAGCACGACTGCATTCAAACTACTACAAGCAC AAGTACCCTCGCCCCAGAGACACCAGCTTCAGTGGCCTGTCCGTGGAAGAGTACAAGCTGATCCTGTCCA CAGACACTTTGGAGGAGTTTCAAGAGATGAATAAGAGTGTGTGGAGGAAACTGCAGGAGAAGTTTGCGCC CACAAGGCCCGAGGAGAAGCACAGAGCCTGGACTCGGGTGCTGTCCCGCCCACGGACCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001108528 |
Insert Size | 411 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001108528.1, NP_001101998.1 |
RefSeq Size | 501 bp |
RefSeq ORF | 411 bp |
Locus ID | 361805 |
UniProt ID | B5DFN3 |
Gene Summary | Required for the assembly of the ubiquinol-cytochrome c reductase complex (mitochondrial respiratory chain complex III or cytochrome b-c1 complex). Plays a role in the modulation of respiratory chain activities such as oxygen consumption and ATP production and via its modulation of the respiratory chain activity can regulate skeletal muscle differentiation and insulin secretion by pancreatic beta-cells. Involved in cytochrome b translation and/or stability.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RR210575 | Mnf1 (Myc-DDK-tagged ORF) - Rat similar to RIKEN cDNA 2900010M23 (RGD1306917), (10 ug) |
CNY 3,990.00 |
|
RR210575L3 | Lenti ORF clone of Mnf1 (Myc-DDK-tagged ORF) - Rat similar to RIKEN cDNA 2900010M23 (RGD1306917), (10 ug) |
CNY 6,080.00 |
|
RR210575L4 | Lenti ORF clone of Mnf1 (mGFP-tagged ORF) - Rat similar to RIKEN cDNA 2900010M23 (RGD1306917), (10 ug) |
CNY 6,650.00 |