Gpr18 (NM_001079710) Rat Untagged Clone

CAT#: RN212625

Gpr18 (untagged ORF) - Rat G protein-coupled receptor 18 (Gpr18), (10 ug)



  "NM_001079710" in other vectors (3)

CNY 3,990.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (2)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Synonyms MGC156838
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN212625 representing NM_001079710
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCCATCCCGAGCAATCGCGACCAGCTTGCTCTTTCCAATGGTTCACACCCAGAGGAATACAAAATCG
CAGCCCTGGTCTTCTACAGCTGCATCTTCCTGATTGGGCTGCTTGTTAATGTCACTGCCCTATGGGTTTT
CAGCTGTACGACCAAGAAAAGAACCACCGTAACCATCTACATGATGAACGTCGCACTGCTGGACTTAGTA
TTTATACTGAGTCTACCCTTTCGGATGTTTTACTATGCAAAAGGCGAGTGGCCATTTGGAGACTACTTCT
GCCACATTCTTGGGGCCCTGGTGGTGTTTTACCCAAGCCTTGCTCTGTGGCTTCTTGCTCTCATTAGTGC
TGACAGATACATGGCCATAGTACAGCCGAAATACGCCAAGGAACTCAAGAACACTGGCAAGGCGGTGCTC
GCGTGTGTGGGGGTCTGGATAATGACCCTGACCACCACTGTCCCTCTGCTACTGCTCGATGAAGACCCAG
ATAAGGCCTCCTCCCCGGCCACCTGCCTGAAGATCTCCGACATCATCCACTTAAAAGCTGTCAATGTGCT
TAACTTCACGCGACTCATATTTTTCTTCCTGATCCCTCTGTTCATCATGATCGGGTGCTACGTGGTCATC
ATTCACAGCCTCCTCCGCGGGCAGACGTCTAAGCTGAAGCCCAAGGTCAAGGAGAAGTCCATACGGATCA
TCGTCACGCTCCTGCTGCAGGTGCTTGCCTGCTTCGTGCCCTTCCACATCTGTTTTGCTCTCCTGATGCT
ACAGGGGGAGGAGAACAGCTACAGCCCCTGGGGAGCCTTCACCACCTTCCTCATGAACCTCAGCACGTGT
CTCGACGTCGTTCTCTACTACATTGTTTCCAAACAGTTCCAGGCTCGAGTCATCAGTGTCATGCTGTACC
GCAATTACCTTCGCAGTGTGCGCAGAAAAAGTGTCCGGTCAGGCAGTCTACGGTCACTTAGCAACATGAA
CAGTGAAATGCTTTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001079710
Insert Size 996 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001079710.1, NP_001073178.1
RefSeq Size 1357 bp
RefSeq ORF 996 bp
Locus ID 679957
UniProt ID A1A5S3
Gene Summary Receptor for endocannabinoid N-arachidonyl glycine (NAGly) (PubMed:24431468). However, conflicting results about the role of NAGly as an agonist are reported (By similarity). Can also be activated by plant-derived and synthetic cannabinoid agonists (PubMed:24431468). The activity of this receptor is mediated by G proteins which inhibit adenylyl cyclase (By similarity). May contribute to regulation of the immune system (By similarity). Is required for normal homeostasis of CD8+ subsets of intraepithelial lymphocytes (IELs) (CD8alphaalpha and CD8alphabeta IELs) in small intstine by supporting preferential migration of CD8alphaalpha T-cells to intraepithelial compartment over lamina propria compartment, and by mediating their reconstitution into small intestine after bone marrow transplant (By similarity). Plays a role in hypotensive responses, mediating reduction in intraocular and blood pressure (PubMed:24431468). Mediates NAGly-induced process of reorganization of actin filaments and induction of acrosomal exocytosis (By similarity).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...