United States
Germany
Japan
United Kingdom
China
Sumo1 (NM_001009672) Rat Untagged Clone
CAT＃: RN213137
Sumo1 (untagged ORF) - Rat SMT3 suppressor of mif two 3 homolog 1 (S. cerevisiae) (Sumo1), (10 ug)
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Rat Untagged Clone |
| Tag | Tag Free |
| Synonyms | MGC109561 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>RN213137 representing NM_001009672
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTCTGACCAGGAGGCAAAACCTTCAACTGAGGACTTAGGAGATAAGAAAGAAGGAGAATACATTAAAC TCAAAGTTATTGGACAGGACAGCAGTGAGATCCATTTCAAAGTGAAAATGACAACACATCTCAAGAAGCT CAAAGAATCGTACTGTCAAAGACAGGGAGTTCCAATGAATTCACTCAGGTTTCTCTTTGAAGGTCAGAGA ATTGCTGATAATCATACTCCAAAAGAACTGGGAATGGAGGAAGAAGACGTGATTGAAGTTTATCAGGAAC AAACGGGGGGTCACTCGACGGTTTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001009672 |
| Insert Size | 306 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001009672.1, NP_001009672.1 |
| RefSeq Size | 1150 bp |
| RefSeq ORF | 306 bp |
| Locus ID | 301442 |
| UniProt ID | Q5I0H3 |
| Gene Summary | Ubiquitin-like protein that can be covalently attached to proteins as a monomer or a lysine-linked polymer. Covalent attachment via an isopeptide bond to its substrates requires prior activation by the E1 complex SAE1-SAE2 and linkage to the E2 enzyme UBE2I, and can be promoted by E3 ligases such as PIAS1-4, RANBP2 or CBX4. This post-translational modification on lysine residues of proteins plays a crucial role in a number of cellular processes such as nuclear transport, DNA replication and repair, mitosis and signal transduction. Involved for instance in targeting RANGAP1 to the nuclear pore complex protein RANBP2. Covalently attached to the voltage-gated potassium channel KCNB1; this modulates the gating characteristics of KCNB1. Polymeric SUMO1 chains are also susceptible to polyubiquitination which functions as a signal for proteasomal degradation of modified proteins. May also regulate a network of genes involved in palate development. Covalently attached to ZFHX3.[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RR213137 | Sumo1 (Myc-DDK-tagged ORF) - Rat SMT3 suppressor of mif two 3 homolog 1 (S. cerevisiae) (Sumo1), (10 ug) |
CNY 1,320.00 |
|
| RR213137L3 | Lenti ORF clone of Sumo1 (Myc-DDK-tagged ORF) - Rat SMT3 suppressor of mif two 3 homolog 1 (S. cerevisiae) (Sumo1), (10 ug) |
CNY 6,080.00 |
|
| RR213137L4 | Lenti ORF clone of Sumo1 (mGFP-tagged ORF) - Rat SMT3 suppressor of mif two 3 homolog 1 (S. cerevisiae) (Sumo1), (10 ug) |
CNY 6,650.00 |
