Selenos (NM_173120) Rat Untagged Clone

CAT#: RN213574

Vimp (untagged ORF) - Rat selenoprotein S (Sels), (Note, selenocysteine protein, internal stop codon, see reference data summary)



  "NM_173120" in other vectors (1)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Rat Untagged Clone
Synonyms Sels; sg2; Vimp
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN213574 representing NM_173120
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGATCGCGGGGAGGAACCTCTGTCCGCGAGGCCGGCGCTGGAGACCGAGAGCCTGCGATTCCTGCACG
TCACAGTGGGCTCCCTGCTGGCCAGCTATGGCTGGTACATCCTCTTCAGCTGCGTCCTTCTCTACATTGT
CATCCAGAAGCTCTCCCTGCGACTGAGGGCTTTAAGGCAGAGGCAGCTGGACCAAGCTGAGGCTGTTCTG
GAGCCTGATGTTGTTGTTAAGCGACAAGAGGCTTTAGCAGCTGCTCGTTTGAGAATGCAGGAAGATCTGA
ATGCCCAAGTTGAAAAACATAAGGAAAAACTAAGACAGCTTGAAGAAGAGAAAAGGAGACAGAAGATTGA
AATGTGGGACAGCATGCAAGAAGGCAGAAGTTACAAAAGAAACTCAGGAAGGCCTCAGGAAGAAGATGGT
CCTGGACCTTCTACTTCATCGGTCATCCCCAAAGGAAAATCTGACAAAAAGCCTTTACGGGGAGGTGGTT
ATAACCCTCTGACAGGTGAAGGGGGTGGAACCTGCTCCTGGAGACCTGGACGCAGGGGCCCATCATCTGG
TGGATGAAGCTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_173120
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). The expression of this clone is not guaranteed due to the nature of selenoproteins.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_173120.2, NP_775143.2
RefSeq Size 1173 bp
RefSeq ORF 573 bp
Locus ID 286900
UniProt ID Q8VHV8
Gene Summary This gene encodes a transmembrane protein that is localized in the endoplasmic reticulum (ER). It is involved in the degradation process of misfolded proteins in the ER, and may also have a role in inflammation control. This protein is a selenoprotein, containing the rare amino acid selenocysteine (Sec). Sec is encoded by the UGA codon, which normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, designated the Sec insertion sequence (SECIS) element, that is necessary for the recognition of UGA as a Sec codon, rather than as a stop signal. Two additional phylogenetically conserved stem-loop structures (Stem-loop 1 and Stem-loop 2) in the 3' UTR of this mRNA have been shown to function as modulators of Sec insertion (PMID:23614019). [provided by RefSeq, Jul 2017]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...