Paip2 (NM_001014148) Rat Untagged Clone
CAT#: RN214887
Paip2 (untagged ORF) - Rat poly(A) binding protein interacting protein 2 (Paip2), (10 ug)
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Rat Untagged Clone |
Tag | Tag Free |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>RN214887 representing NM_001014148
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGAAAGATCCAAGTCGCAGCAGTACTAGCCCAAGCATCATCAATGACGATGTGATTATTAACGGTCATT CTCATGAAGAGGATAATCCATTTGCAGAGTACATGTGGATGGAAAATGAAGAGGAATTCAACAGACAAAT AGAAGAGGAGTTGTGGGAAGAAGAATTTATTGAACGCTGTTTCCAAGAAATGCTGGAAGAGGAAGAAGAA CATGAATGGTTTATTCCAGCCCGAGATCTCCCACAAACTATGGACCAAATCCAAGACCAGTTTAATGACC TTGTTATCAGTGATGGCTCTTCTCTGGAAGATCTTGTGGTGAAGAGCAATCTGAATCCCAATGCAAAGGA GTTTGTTCCTGGGGTGAAGTACTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001014148 |
Insert Size | 375 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001014148.1, NP_001014170.1 |
RefSeq Size | 1681 bp |
RefSeq ORF | 375 bp |
Locus ID | 361309 |
UniProt ID | Q6AXZ0 |
Gene Summary | Acts as a repressor in the regulation of translation initiation of poly(A)-containing mRNAs. Its inhibitory activity on translation is mediated via its action on PABPC1. Displaces the interaction of PABPC1 with poly(A) RNA and competes with PAIP1 for binding to PABPC1. Its association with PABPC1 results in disruption of the cytoplasmic poly(A) RNP structure organization (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RR214887 | Paip2 (Myc-DDK-tagged ORF) - Rat poly(A) binding protein interacting protein 2 (Paip2), (10 ug) |
CNY 3,990.00 |
|
RR214887L3 | Lenti ORF clone of Paip2 (Myc-DDK-tagged ORF) - Rat poly(A) binding protein interacting protein 2 (Paip2), (10 ug) |
CNY 6,080.00 |
|
RR214887L4 | Lenti ORF clone of Paip2 (mGFP-tagged ORF) - Rat poly(A) binding protein interacting protein 2 (Paip2), (10 ug) |
CNY 6,650.00 |