Sdhaf1 (NM_001177687) Rat Untagged Clone

CAT#: RN215846

RGD1562079 (untagged) - Rat RGD1562079 (RGD1562079)



  "NM_001177687" in other vectors (1)

CNY 2,000.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Synonyms Lyrm8; RGD1562079
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN215846 representing NM_001177687
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAGCCGGCTTAGCCGGCTGCAGAGGCAAGTTCTGAGCCTGTACCGCGAACTGCTGCGCGCCGGGCGCG
GGAAGCCGGGCGCCGAGGCACGGGTGCGGGCCGAGTTCCGGCAGCACGCCAGCCTTCCGCGCTCCGACGT
GCTGCGTATCGAGTATCTGTATCGCCGGGGACGGCGCCAGCTACAGCTGCTGCGTTCCGGCCACGCCACG
GCCATGGGTACTTTCGTGCGCCCGCGGGGCCCTACTGAAGAACCCGTCGACGCGACAGCCCCGGGGAACA
GGCTGGACGATAGTGATGCCCTAAAGAATCCTTGTGAAGGCACGGGAGCACGGGAAACGCGATCCGATGG
ACGGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001177687
Insert Size 357 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001177687.1, NP_001171158.1
RefSeq Size 986 bp
RefSeq ORF 357 bp
Locus ID 499125
UniProt ID B0K036
Gene Summary Plays an essential role in the assembly of succinate dehydrogenase (SDH), an enzyme complex (also referred to as respiratory complex II) that is a component of both the tricarboxylic acid (TCA) cycle and the mitochondrial electron transport chain, and which couples the oxidation of succinate to fumarate with the reduction of ubiquinone (coenzyme Q) to ubiquinol. Promotes maturation of the iron-sulfur protein subunit Sdhb of the SDH catalytic dimer, protecting it from the deleterious effects of oxidants. May act together with SDHAF3. Contributes to iron-sulfur cluster incorporation into SDHB by binding to SDHB and recruiting the iron-sulfur transfer complex formed by HSC20, HSPA9 and ISCU through direct binding to HSC20.[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...