Cytochrome P450 2C9 (CYP2C9) (BC020754) Human Untagged Clone

CAT#: SC106226

CYP2C9 (untagged)-Homo sapiens, Similar to cytochrome P450, subfamily IIC (mephenytoin 4-hydroxylase), polypeptide 9, clone MGC:22601 IMAGE:4766890, complete cds



CNY 1,200.00

CNY 6,270.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
CYP2C9 (Cytochrome P450 2C9) mouse monoclonal antibody, clone OTI1D7 (formerly 1D7)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CPC9; CYP2C; CYP2C10; cytochrome P-450 S-mephenytoin 4-hydroxylase; cytochrome P450, subfamily IIC (mephenytoin 4-hydroxylase); cytochrome P450, subfamily IIC (mephenytoin 4-hydroxylase), polypeptide 10; MGC88320; MGC149605; OTTHUMP00000020135; P450IIC9
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for BC020754 edited
TTCAATGGATTCTCTTGTGGTCCTTGTGCTCTGTCTCTCATGTTTGCTTCTCCTTTCACT
CTGGAGACAGAGCTCTGGGAGAGGAAAACTCCCTCCTGGCCCCACTCCTCTCCCAGTGAT
TGGAAATATCCTACAGATAGGTATTAAGGACATCAGCAAATCCTTAACCAATCTCTCAAA
GGTCTATGGCCCTGTGTTCACTCTGTATTTTGGCCTGAAACCCATAGTGGTGCTGCATGG
ATATGAAGCAGTGAAGGAAGCCCTGATTGATCTTGGAGAGGAGTTTTCTGGAAGAGGCAT
TTTCCCACTGGCTGAAAGAGCTAACAGAGGATTTGGAATTGTTTTCAGCAATGGAAAGAA
ATGGAAGGAGATCCGGCGTTTCTCCCTCATGACGCTGCGGAATTTTGGGATGGGGAAGAG
GAGCATTGAGGACCGTGTTCAAGAGGAAGCCCGCTGCCTTGTGGAGGAGTTGAGAAAAAC
CAAGGGTGGGTGA
Restriction Sites Please inquire     
ACCN BC020754
Insert Size 500 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to BC020754.1.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC020754.1, AAH20754.1
RefSeq Size 1459 bp
RefSeq ORF 489 bp
Locus ID 1559
Protein Families Druggable Genome, P450
Protein Pathways Arachidonic acid metabolism, Drug metabolism - cytochrome P450, Linoleic acid metabolism, Metabolic pathways, Metabolism of xenobiotics by cytochrome P450, Retinol metabolism
Gene Summary This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum and its expression is induced by rifampin. The enzyme is known to metabolize many xenobiotics, including phenytoin, tolbutamide, ibuprofen and S-warfarin. Studies identifying individuals who are poor metabolizers of phenytoin and tolbutamide suggest that this gene is polymorphic. The gene is located within a cluster of cytochrome P450 genes on chromosome 10q24. [provided by RefSeq, Jul 2008]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
Customer Reviews 
Loading...