Cytochrome P450 2C9 (CYP2C9) (BC020754) Human Untagged Clone
CAT#: SC106226
CYP2C9 (untagged)-Homo sapiens, Similar to cytochrome P450, subfamily IIC (mephenytoin 4-hydroxylase), polypeptide 9, clone MGC:22601 IMAGE:4766890, complete cds
CNY 1,200.00
CNY 6,270.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CPC9; CYP2C; CYP2C10; cytochrome P-450 S-mephenytoin 4-hydroxylase; cytochrome P450, subfamily IIC (mephenytoin 4-hydroxylase); cytochrome P450, subfamily IIC (mephenytoin 4-hydroxylase), polypeptide 10; MGC88320; MGC149605; OTTHUMP00000020135; P450IIC9 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for BC020754 edited
TTCAATGGATTCTCTTGTGGTCCTTGTGCTCTGTCTCTCATGTTTGCTTCTCCTTTCACT CTGGAGACAGAGCTCTGGGAGAGGAAAACTCCCTCCTGGCCCCACTCCTCTCCCAGTGAT TGGAAATATCCTACAGATAGGTATTAAGGACATCAGCAAATCCTTAACCAATCTCTCAAA GGTCTATGGCCCTGTGTTCACTCTGTATTTTGGCCTGAAACCCATAGTGGTGCTGCATGG ATATGAAGCAGTGAAGGAAGCCCTGATTGATCTTGGAGAGGAGTTTTCTGGAAGAGGCAT TTTCCCACTGGCTGAAAGAGCTAACAGAGGATTTGGAATTGTTTTCAGCAATGGAAAGAA ATGGAAGGAGATCCGGCGTTTCTCCCTCATGACGCTGCGGAATTTTGGGATGGGGAAGAG GAGCATTGAGGACCGTGTTCAAGAGGAAGCCCGCTGCCTTGTGGAGGAGTTGAGAAAAAC CAAGGGTGGGTGA |
Restriction Sites | Please inquire |
ACCN | BC020754 |
Insert Size | 500 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to BC020754.1. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC020754.1, AAH20754.1 |
RefSeq Size | 1459 bp |
RefSeq ORF | 489 bp |
Locus ID | 1559 |
Protein Families | Druggable Genome, P450 |
Protein Pathways | Arachidonic acid metabolism, Drug metabolism - cytochrome P450, Linoleic acid metabolism, Metabolic pathways, Metabolism of xenobiotics by cytochrome P450, Retinol metabolism |
Gene Summary | This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum and its expression is induced by rifampin. The enzyme is known to metabolize many xenobiotics, including phenytoin, tolbutamide, ibuprofen and S-warfarin. Studies identifying individuals who are poor metabolizers of phenytoin and tolbutamide suggest that this gene is polymorphic. The gene is located within a cluster of cytochrome P450 genes on chromosome 10q24. [provided by RefSeq, Jul 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
其它Cytochrome P450 2C9产品