PHPT1 (NM_014172) Human Untagged Clone

CAT#: SC108149

PHPT1 (untagged)-Human phosphohistidine phosphatase 1 (PHPT1), transcript variant 3



  "NM_014172" in other vectors (6)

CNY 1,200.00

CNY 2,950.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


PHPT1 rabbit polyclonal antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CGI-202; HEL-S-132P; HSPC141; PHP; PHP14
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF within SC108149 sequence for NM_014172 edited (data generated by NextGen Sequencing)
ATGGCGGTGGCGGACCTCGCTCTCATTCCTGATGTGGACATCGACTCCGACGGCGTCTTC
AAGTATGTGCTGATCCGAGTCCACTCGGCTCCCCGCTCCGGGGCTCCGGCTGCAGAGAGC
AAGGAGATCGTGCGCGGCTACAAGTGGGCTGAGTACCATGCGGACATCTACGACAAAGTG
TCGGGCGACATGCAGAAGCAAGGCTGCGACTGTGAGTGTCTGGGCGGCGGGCGCATCTCC
CACCAGAGTCAGGACAAGAAGATTCACGTGTACGGCTATTCCATGGCCTATGGTCTTGCC
CAGCACGCCATTTCAACTGAGAAAATCAAAGCCAAGTACCCCGACTACGAGGTCACCTGG
GCTAACGACGGCTACTGA

Clone variation with respect to NM_014172.4
296 c=>t
>OriGene 5' read for NM_014172 unedited
GCACGAGGCCGGGAGGAGGAACATGGCGGTGGCGGACCTCGCTCTCATTCCTGATGTGGA
CATCGACTCCGACGGCGTCTTCAAGTATGTGCTGATCCGAGTCCACTCGGCTCCCCGCTC
CGGGGCTCCGGCTGCAGAGAGCAAGGAGATCGTGCGCGGCTACAAGTGGGCTGAGTACCA
TGCGGACATCTACGACAAAGTGTCGGGCGACATGCAGAAGCAAGGCTGCGACTGTGAGTG
TCTGGGCGGCGGGCGCATCTCCCACCAGAGTCAGGACAAGAAGATTCACGTGTACGGCTA
TTCCATGGCCTATGGTCTTGCCCAGCACGCCATTTCAACTGAGAAAATCAAAGCCAAGTA
CCCCGACTACGAGGTCACCTGGGCTAACGACGGCTACTGAGCACTCCCAGCCCGGGGCCT
GCTGCCTCCAGCAGCCACTTCAGAGCCCCCGCCTTTGCCTGCACTCCTCTTGCAGGGCTG
GCCCTGCCTGCTCCTGCGGCAGCCTCTGGTGACGTGCTGTCCACCAGGCCTTGGAGACAG
GCTAGCCTGGCCACAGAATTAAACGTGTTGCCACACCTGCCGGCTTCTGAAAAAAAAAAA
AAAA
Restriction Sites NotI-NotI     
ACCN NM_014172
Insert Size 660 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_014172.2, NP_054891.2
RefSeq Size 903 bp
RefSeq ORF 378 bp
Locus ID 29085
UniProt ID Q9NRX4
Domains Ocnus
Protein Families Druggable Genome
Protein Pathways Fructose and mannose metabolism, Metabolic pathways, Riboflavin metabolism, Thiamine metabolism
Gene Summary This gene encodes an enzyme that catalyzes the reversible dephosphorylation of histidine residues in proteins. It may be involved in the dephosphorylation of G-beta and ATP citrate lyase and in negatively regulating CD4 T lymphocytes by dephosphorylation and inhibition of KCa3.1 channels. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
Transcript Variant: This variant (3) uses an alternate in-frame splice site in the 5' coding region, compared to variant 4. It encodes isoform 3, which is shorter than isoform 4.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...