GH2 (NM_022557) Human Untagged Clone
CAT#: SC109273
GH2 (untagged)-Human growth hormone 2 (GH2), transcript variant 2
CNY 3,990.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | GH-V; GHB2; GHL; GHV; hGH-V |
Vector | pCMV6-XL4 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_022557, the custom clone sequence may differ by one or more nucleotides
ATGGCTGCAGGCTCCCGGACGTCCCTGCTCCTGGCTTTTGGCCTGCTCTGCCTGTCCTGGCTTCAAGAGG GCAGTGCCTTCCCAACCATTCCCTTATCCAGGCTTTTTGACAACGCTATGCTCCGCGCCCGTCGCCTGTA CCAGCTGGCATATGACACCTATCAGGAGTTTGAAGAAGCCTATATCCTGAAGGAGCAGAAGTATTCATTC CTGCAGAACCCCCAGACCTCCCTCTGCTTCTCAGAGTCTATTCCAACACCTTCCAACAGGGTGAAAACGC AGCAGAAATCTAACCTAGAGCTGCTCCGCATCTCCCTGCTGCTCATCCAGTCATGGCTGGAGCCCGTGCA GCTCCTCAGGAGCGTCTTCGCCAACAGCCTGGTGTATGGCGCCTCGGACAGCAACGTCTATCGCCACCTG AAGGACCTAGAGGAAGGCATCCAAACGCTGATGTGGGTGAGGGTGGCACCAGGGATCCCCAATCCTGGGG CCCCACTGGCTTCCAGGGACTGGGGAGAGAAACACTGCTGCCCTCTTTTTAGCAGTCAGGCGCTGACCCA AGAGAACTCACCGTATTCTTCATTTCCCCTCGTGAATCCTCCAGGCCTTTCTCTACAACCTGGAGGGGAG GGAGGAAAATGGATGAATGAGAGAGGGAGGGAACAGTGCCCAAGCGCTTGGCCTCTCCTTCTCTTCCTTC ACTTTGCAGAGGCTGGAAGATGGCAGCCCCCGGACTGGGCAGATCTTCAATCAGTCCTACAGCAAGTTTG A |
Restriction Sites | Please inquire |
ACCN | NM_022557 |
Insert Size | 860 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_022557.2, NP_072051.1 |
RefSeq Size | 1078 bp |
RefSeq ORF | 771 bp |
Locus ID | 2689 |
UniProt ID | P01242 |
Domains | hormone |
Protein Families | Druggable Genome, Secreted Protein |
Protein Pathways | Cytokine-cytokine receptor interaction, Jak-STAT signaling pathway, Neuroactive ligand-receptor interaction |
Gene Summary | The protein encoded by this gene is a member of the somatotropin/prolactin family of hormones which play an important role in growth control. The gene, along with four other related genes, is located at the growth hormone locus on chromosome 17 where they are interspersed in the same transcriptional orientation; an arrangement which is thought to have evolved by a series of gene duplications. The five genes share a remarkably high degree of sequence identity. Alternative splicing generates additional isoforms of each of the five growth hormones, leading to further diversity and potential for specialization. As in the case of its pituitary counterpart, growth hormone 1, the predominant isoform of this particular family member shows similar somatogenic activity, with reduced lactogenic activity. Mutations in this gene lead to placental growth hormone/lactogen deficiency. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) utilizes intron D to generate the longest isoform (2), which diverges from all other GH isoforms in the carboxy terminus. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC218142 | GH2 (Myc-DDK-tagged)-Human growth hormone 2 (GH2), transcript variant 2 |
CNY 2,400.00 |
|
RC218142L3 | Lenti ORF clone of Human growth hormone 2 (GH2), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC218142L4 | Lenti ORF clone of Human growth hormone 2 (GH2), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RG218142 | GH2 (tGFP-tagged) - Human growth hormone 2 (GH2), transcript variant 2 |
CNY 4,370.00 |