MRPL42 (NM_172177) Human Untagged Clone

CAT#: SC110400

MRPL42 (untagged)-Human mitochondrial ribosomal protein L42 (MRPL42), nuclear gene encoding mitochondrial protein, transcript variant 2



  "NM_172177" in other vectors (4)

CNY 1,200.00

CNY 2,950.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
MRPL42 mouse monoclonal antibody,clone OTI1A4
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms HSPC204; L31MT; L42MT; MRP-L31; MRP-L42; MRP-S32; MRPL31; MRPS32; PTD007; RPML31; S32MT
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF within SC110400 sequence for NM_172177 edited (data generated by NextGen Sequencing)
ATGGCTGTAGCTGCAGTAAAATGGGTGATGTCAAAGAGAACTATCTTGAAACATTTATTT
CCAGTCCAAAATGGAGCTTTATATTGTGTTTGTCATAAATCTACGTATTCTCCTCTACCA
GATGACTATAATTGCAACGTAGAGCTTGCTCTGACTTCTGATGGCAGGACAATAGTATGC
TACCACCCTTCTGTGGACATTCCATATGAACACACAAAACCTATCCCTCGGCCAGATCCT
GTGCATAATAATGAAGAAACACATGATCAAGTGCTGAAAACCAGATTGGAAGAAAAAGTT
GAACACCTTGAGGAAGGACCTATGATAGAACAACTTAGCAAAATGTTCTTTACTACTAAG
CACCGTTGGTATCCTCATGGACGGTATCACAGATGTCGTAAGAATCTGAATCCTCCAAAA
GACAGATGA

Clone variation with respect to NM_172177.3
>OriGene 5' read for NM_172177 unedited
CGAATTCGGCACGAGGAGAAGCCGTCAAGGAGTAGAAATTGGTATGCTTAGAAGCAGATT
CTAAAAGCAGTTTCTCTTCAGAACATCTTTTTTCATACCACTTGATAAGCATCTTGAAAC
ACCATGGCTGTAGCTGCAGTAAAATGGGTGATGTCAAAGAGAACTATCTTGAAACATTTA
TTTCCAGTCCAAAATGGAGCTTTATATTGTGTTTGTCATAAATCTACGTATTCTCCTCTA
CCAGATGACTATAATTGCAACGTAGAGCTTGCTCTGACTTCTGATGGCAGGACAATAGTA
TGCTACCACCCTTCTGTGGACATTCCATATGAACACACAAAACCTATCCCTCGGCCAGAT
CCTGTGCATAATAATGAAGAAACACATGATCAAGTGCTGAAAACCAGATTGGAAGAAAAA
GTTGAACACCTTGAGGAAGGACCTATGATAGAACAACTTAGCAAAATGTTCTTTACTACT
AAGCACCGTTGGTATCCTCATGGACGGTATCACAGATGTCGTAAGAATCTGAATCCTCCA
AAAGACAGATGATGCGGAGGTTCCTGGGGGAATCAAAGAGAAATGTGCCTCATTTGCCAT
TTGAGAAAATGCAGTCTGGTGTATTCAGTAATATATAGTAAAGTAATAATGATAAAATAT
CTTTTCATATATTAGAATGTGTACTTTTATATAAAGTAATTCTGGATTTGACATTCTCAT
TTAGAGAAACCTATTTTCTTTNTTCTTTNTCTATTTTAGTGTTTCATT
Restriction Sites NotI-NotI     
ACCN NM_172177
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_172177.1, NP_751917.1
RefSeq Size 2073 bp
RefSeq ORF 429 bp
Locus ID 28977
UniProt ID Q9Y6G3
Gene Summary Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a protein identified as belonging to both the 28S and the 39S subunits. Alternative splicing results in multiple transcript variants. Pseudogenes corresponding to this gene are found on chromosomes 4q, 6p, 6q, 7p, and 15q. [provided by RefSeq, May 2011]
Transcript Variant: This variant (2) differs in the 5' UTR, compared to variant 1. Both variants 1 and 2 encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...