Histone H2A.J (H2AFJ) (NM_177925) Human Untagged Clone

CAT#: SC110528

H2AFJ (untagged)-Human H2A histone family, member J (H2AFJ), transcript variant 1



  "NM_177925" in other vectors (4)

CNY 1,200.00

CNY 2,950.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


H2AJ rabbit polyclonal antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms H2AFJ
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF within SC110528 sequence for NM_177925 edited (data generated by NextGen Sequencing)
ATGTCCGGTCGCGGGAAACAGGGCGGCAAAGTGCGAGCAAAGGCCAAATCCCGCTCCTCC
CGCGCGGGCCTGCAGTTCCCGGTGGGCCGAGTGCACAGACTGCTGCGCAAAGGGAACTAC
GCGGAGCGAGTGGGCGCCGGGGCGCCGGTGTACCTGGCGGCGGTGTTGGAGTACCTTACG
GCGGAGATCCTGGAGCTGGCTGGCAACGCCGCGCGTGACAACAAGAAGACCAGGATAATT
CCCCGCCACCTGCAGCTCGCCATCCGCAACGACGAGGAGTTAAACAAGCTGCTGGGCAAA
GTGACCATCGCTCAGGGCGGCGTCCTGCCCAACATCCAGGCCGTGCTGCTGCCCAAGAAG
ACGGAGAGTCAGAAGACGAAGAGCAAATGA

Clone variation with respect to NM_177925.2
>OriGene 5' read for NM_177925 unedited
ACGAGGGTTTGTAGAGGCAGTTCGGGTGCGGTACGTTGCATTCCGGTACCGGNACGCCGA
GAGCGGTTTGTCTCCGTCTCTGGAGTTGTAGGCGAGAGGTGATCATGTCCGGTCGCGGGA
AACAGGGCGGCAAAGTGCGAGCAAAGGCCAAATCCCGCTCCTCCCGCGCGGGCCTGCAGT
TCCCGGTGGGCCGAGTGCACAGACTGCTGCGCAAAGGGAACTACGCGGAGCGAGTGGGCG
CCGGGGCGCCGGTGTACCTGGCGGCGGTGTTGGAGTACCTTACGGCGGAGATCCTGGAGC
TGGCTGGCAACGCCGCGCGTGACAACAAGAAGACCAGGATAATTCCCCGCCACCTGCAGC
TCGCCATCCGCAACGACGAGGAGTTAAACAAGCTGCTGGGCAAAGTGACCATCGCTCAGG
GCGGCGTCCTGCCCAACATCCAGGCCGTGCTGCTGCCCAAGAAGACGGAGAGTCAGAAGA
CGAAGAGCAAATGACCCTGACGCCGCCCTCAGGGGAGCTGGCTCCCCCAGCAAAGGCCCT
TTTCATGGTCGTCCCGCAATGCTTTTGAATGTGCTTGGATGTATTGGAGGGCCGGTGACA
TCTACGGGGGAAGGTGGGCGGCCNAGGGTCCCGGCGGGAGCCAATAAAGTTGGTGAAAAT
CGTTTGGTCNAGAGAGCTGTGTAGTCGCGGGGACATGTCGGATGGCCCCAGGGGAAGGGG
GGCGACCGGGAAACCCCTGGAGCAGGCCTGG
Restriction Sites NotI-NotI     
ACCN NM_177925
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_177925.1, NP_808760.1
RefSeq Size 725 bp
RefSeq ORF 390 bp
Locus ID 55766
UniProt ID Q9BTM1
Protein Pathways Systemic lupus erythematosus
Gene Summary Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Nucleosomes consist of approximately 146 bp of DNA wrapped around a histone octamer composed of pairs of each of the four core histones (H2A, H2B, H3, and H4). The chromatin fiber is further compacted through the interaction of a linker histone, H1, with the DNA between the nucleosomes to form higher order chromatin structures. This gene is located on chromosome 12 and encodes a replication-independent histone that is a variant H2A histone. The protein is divergent at the C-terminus compared to the consensus H2A histone family member. This gene also encodes an antimicrobial peptide with antibacterial and antifungal activity.[provided by RefSeq, Oct 2015]
Transcript Variant: This variant (1) represents the longer transcript and encodes the functional protein. ##RefSeq-Attributes-START## Protein has antimicrobial activity :: PMID: 21178486 RefSeq Select criteria :: based on single protein-coding transcript replication-independent histone :: PMID: 25731851 ##RefSeq-Attributes-END## COMPLETENESS: complete on the 3' end.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...