Acid Phosphatase (ACP1) (NM_004300) Human Untagged Clone
CAT#: SC111923
ACP1 (untagged)-Human acid phosphatase 1, soluble (ACP1), transcript variant 3
CNY 1,200.00
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | HAAP; LMW-PTP; LMWPTP |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene ORF within SC111923 sequence for NM_004300 edited (data generated by NextGen Sequencing)
ATGGCGGAACAGGCTACCAAGTCCGTGCTGTTTGTGTGTCTGGGTAACATTTGTCGATCA CCCATTGCAGAAGCAGTTTTCAGGAAACTTGTAACCGATCAAAACATCTCAGAGAATTGG AGGGTAGACAGCGCGGCAACTTCCGGGTATGAGATAGGGAACCCCCCTGACTACCGAGGG CAGAGCTGCATGAAGAGGCACGGCATTCCCATGAGCCACGTTGCCCGGCAGATTACCAAA GAAGATTTTGCCACATTTGATTATATACTATGTATGGATGAAAGCAATCTGAGAGATTTG AATAGAAAAAGTAATCGAGTTAAAACCTGCAAAGCTAAAATTGAACTACTTGGGAGCTAT GATCCACAAAAACAACTTATTATTGAAGATCCCTATTATGGGAATGACTCTGACTTTGAG ACGGTGTACCAGCAGTGTGTCAGGTGCTGCAGAGCGTTCTTGGAGAAGGCCCACTGA Clone variation with respect to NM_004300.3 317 a=>g |
Restriction Sites | NotI-NotI |
ACCN | NM_004300 |
Insert Size | 1570 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_004300.2, NP_004291.1 |
RefSeq Size | 1549 bp |
RefSeq ORF | 477 bp |
Locus ID | 52 |
UniProt ID | P24666 |
Domains | LMWPc |
Protein Families | Druggable Genome, Phosphatase, Transmembrane |
Protein Pathways | Adherens junction, Riboflavin metabolism |
Gene Summary | The product of this gene belongs to the phosphotyrosine protein phosphatase family of proteins. It functions as an acid phosphatase and a protein tyrosine phosphatase by hydrolyzing protein tyrosine phosphate to protein tyrosine and orthophosphate. This enzyme also hydrolyzes orthophosphoric monoesters to alcohol and orthophosphate. This gene is genetically polymorphic, and three common alleles segregating at the corresponding locus give rise to six phenotypes. Each allele appears to encode at least two electrophoretically different isozymes, Bf and Bs, which are produced in allele-specific ratios. Multiple alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Aug 2008] Transcript Variant: This variant (3) has multiple differences in the coding region, compared to variant 4. The resulting protein (isoform c, also known as Bf) has a distinct C-terminus and is longer than isoform d. Sequence Note: The RefSeq transcript and protein were derived from transcript and genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC212653 | ACP1 (Myc-DDK-tagged)-Human acid phosphatase 1, soluble (ACP1), transcript variant 3 |
CNY 1,200.00 |
|
RC212653L1 | Lenti ORF clone of Human acid phosphatase 1, soluble (ACP1), transcript variant 3, Myc-DDK-tagged |
CNY 3,600.00 |
|
RC212653L2 | Lenti ORF clone of Human acid phosphatase 1, soluble (ACP1), transcript variant 3, mGFP tagged |
CNY 5,890.00 |
|
RC212653L3 | Lenti ORF clone of Human acid phosphatase 1, soluble (ACP1), transcript variant 3, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC212653L4 | Lenti ORF clone of Human acid phosphatase 1, soluble (ACP1), transcript variant 3, mGFP tagged |
CNY 3,600.00 |
|
RG212653 | ACP1 (tGFP-tagged) - Human acid phosphatase 1, soluble (ACP1), transcript variant 3 |
CNY 2,800.00 |
其它Acid Phosphatase产品