SNURF (NM_022804) Human Untagged Clone

CAT#: SC112432

SNURF (untagged)-Human SNRPN upstream reading frame (SNURF), transcript variant 2



  "NM_022804" in other vectors (4)

CNY 1,200.00

CNY 3,990.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF within SC112432 sequence for NM_022804 edited (data generated by NextGen Sequencing)
ATGGAGCGGGCAAGGGATCGCTTACACCTGAGACGAACTACAGAACAGCACGTACCAGAG
GTGGAAGTCCAAGTCAAACGCAGAAGGACTGCCTCACTGAGCAACCAAGAGTGTCAGTTG
TACCCGAGGCGTTCTCAGCAGCAGCAAGTACCTGTGGTGGATTTCCAGGCTGAACTGAGG
CAGGCATTCTTAGCTGAGACACCAAGAGGTGGTTAA

Clone variation with respect to NM_022804.2
>OriGene 5' read for NM_022804 unedited
TAATACGACTCACTATAGGGCGGCCGCGAATTCGGCACGAGGGATGCCTGACGCATCTGT
CTGAGGAGCGGTCAGTGACGCGATGGAGCGGGCAAGGGATCGCTTACACCTGAGACGAAC
TACAGAACAGCACGTACCAGAGGTGGAAGTCCAAGTCAAACGCAGAAGGACTGCCTCACT
GAGCAACCAAGAGTGTCAGTTGTACCCGAGGCGTTCTCAGCAGCAGCAAGTACCTGTGGT
GGATTTCCAGGCTGAACTGAGGCAGGCATTCTTAGCTGAGACACCAAGAGGTGGTTAAAG
CCATATTGGAGTAGCGAGGAATCTGATTCCAAGCAAAAACCAGGCTCCATCTACTCTTTG
AAGCTTCTGCCCAGCTTGCATTGTTTCTAGGAGAACCTGCGTCATACCTTTATCTATAGC
CTTCCCCTAGGTCTTCAGAAGCATCAAGTTTTAACTGTGGACATTGGATTTGGTGGAACA
GCAATCATGACTGTTGGCAAGAGTAGCAAGATGCTGCAGCACATTGACTATAGAATGAGA
TGTATCCTGCAAGATGGCCGAATCTTCATTGGCACCTTTAAGGCTTTTGACAAGCATATG
AATTTGATCCTCTGTGATTGTGATGAGTTCAGAAAGATCAAGCCAAAGAATGCGAAGCAA
CCAGAGCGTGAAAAAAGCGGGTTTTGGGGTCTGGGTGGTGCTGCGTGGGGAGAACTTGGT
ATCCATGACTGTGNGAGGNGCCCACCCCCCANAGATACTGGCATTGCTCGGNNTACCCAC
TTGCTGAGCTGCTGGNAGCCCCTGNNNGGTTGTAGGGCANCTGTAAAAGGATACCANCTG
GTGTGCCATTCCCCAGCCCCCTGCTGATNGNCAGCCCTGTCCAAGGGATTGGGGGACATN
CCANCAGTATGACTCCAGGNA
Restriction Sites NotI-NotI     
ACCN NM_022804
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_022804.1, NP_073715.1
RefSeq Size 347 bp
RefSeq ORF 216 bp
Locus ID 8926
UniProt ID Q9Y675
Protein Families Stem cell - Pluripotency
Gene Summary This gene is located within the Prader-Willi Syndrome critical region on chromosome 15. Transcripts produced from this gene initiate at an imprinting center and are paternally-imprinted. These transcripts may be bicistronic and also encode SNRPN (small nuclear ribonucleoprotein polypeptide N) from a downstream open reading frame. The small protein represented by this gene is encoded by an evolutionarily-conserved upstream open reading frame and is localized to the nucleus. Extensive alternative splicing and promoter usage occurs in this region and the full-length nature of some of these transcripts has not been determined. Alterations in the imprinting center are associated with parental imprint switch failure, which may cause Angelman syndrome or Prader-Willi syndrome. [provided by RefSeq, Mar 2017]
Transcript Variant: This variant (2) lacks multiple 3' exons and contains an alternate 3' UTR compared to variant 1. This variant is monocistronic and cannot encode the SNRPN protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...