SynCAM (CADM1) (NM_014333) Human Untagged Clone

CAT#: SC115048

CADM1 (untagged)-Human cell adhesion molecule 1 (CADM1), transcript variant 1



  "NM_014333" in other vectors (6)

CNY 7,030.00


货期*
2周

规格
    • 10 ug

Cited in 1 publication.

Product images

经常一起买 (3)
Rabbit Polyclonal CADM1 Antibody
    • 100 ul

CNY 4,400.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms BL2; IGSF4; IGSF4A; Necl-2; NECL2; RA175; sgIGSF; ST17; sTSLC-1; SYNCAM; synCAM1; TSLC1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC115048 representing NM_014333.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCGAGTGTAGTGCTGCCGAGCGGATCCCAGTGTGCGGCGGCAGCGGCGGCGGCGGCGCCTCCCGGG
CTCCGGCTCCGGCTTCTGCTGTTGCTCTTCTCCGCCGCGGCACTGATCCCCACAGGTGATGGGCAGAAT
CTGTTTACGAAAGACGTGACAGTGATCGAGGGAGAGGTTGCGACCATCAGTTGCCAAGTCAATAAGAGT
GACGACTCTGTGATTCAGCTACTGAATCCCAACAGGCAGACCATTTATTTCAGGGACTTCAGGCCTTTG
AAGGACAGCAGGTTTCAGTTGCTGAATTTTTCTAGCAGTGAACTCAAAGTATCATTGACAAACGTCTCA
ATTTCTGATGAAGGAAGATACTTTTGCCAGCTCTATACCGATCCCCCACAGGAAAGTTACACCACCATC
ACAGTCCTGGTCCCACCACGTAATCTGATGATCGATATCCAGAAAGACACTGCGGTGGAAGGTGAGGAG
ATTGAAGTCAACTGCACTGCTATGGCCAGCAAGCCAGCCACGACTATCAGGTGGTTCAAAGGGAACACA
GAGCTAAAAGGCAAATCGGAGGTGGAAGAGTGGTCAGACATGTACACTGTGACCAGTCAGCTGATGCTG
AAGGTGCACAAGGAGGACGATGGGGTCCCAGTGATCTGCCAGGTGGAGCACCCTGCGGTCACTGGAAAC
CTGCAGACCCAGCGGTATCTAGAAGTACAGTATAAGCCTCAAGTGCACATTCAGATGACTTATCCTCTA
CAAGGCTTAACCCGGGAAGGGGACGCGCTTGAGTTAACATGTGAAGCCATCGGGAAGCCCCAGCCTGTG
ATGGTAACTTGGGTGAGAGTCGATGATGAAATGCCTCAACACGCCGTACTGTCTGGGCCCAACCTGTTC
ATCAATAACCTAAACAAAACAGATAATGGTACATACCGCTGTGAAGCTTCAAACATAGTGGGGAAAGCT
CACTCGGATTATATGCTGTATGTATACGATCCCCCCACAACTATCCCTCCTCCCACAACAACCACCACC
ACCACCACCACCACCACCACCACCATCCTTACCATCATCACAGATTCCCGAGCAGGTGAAGAAGGCTCG
ATCAGGGCAGTGGATCATGCCGTGATCGGTGGCGTCGTGGCGGTGGTGGTGTTCGCCATGCTGTGCTTG
CTCATCATTCTGGGGCGCTATTTTGCCAGACATAAAGGTACATACTTCACTCATGAAGCCAAAGGAGCC
GATGACGCAGCAGACGCAGACACAGCTATAATCAATGCAGAAGGAGGACAGAACAACTCCGAAGAAAAG
AAAGAGTACTTCATCTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_014333
Insert Size 1329 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_014333.2.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_014333.3
RefSeq Size 4324 bp
RefSeq ORF 1329 bp
Locus ID 23705
UniProt ID Q9BY67
Domains ig, IGc2, IG
Protein Families Transmembrane
Protein Pathways Cell adhesion molecules (CAMs)
MW 48.5 kDa
Gene Summary Mediates homophilic cell-cell adhesion in a Ca(2+)-independent manner. Also mediates heterophilic cell-cell adhesion with CADM3 and NECTIN3 in a Ca(2+)-independent manner. Acts as a tumor suppressor in non-small-cell lung cancer (NSCLC) cells. Interaction with CRTAM promotes natural killer (NK) cell cytotoxicity and interferon-gamma (IFN-gamma) secretion by CD8+ cells in vitro as well as NK cell-mediated rejection of tumors expressing CADM3 in vivo. May contribute to the less invasive phenotypes of lepidic growth tumor cells. In mast cells, may mediate attachment to and promote communication with nerves. CADM1, together with MITF, is essential for development and survival of mast cells in vivo. Acts as a synaptic cell adhesion molecule and plays a role in the formation of dendritic spines and in synapse assembly (By similarity). May be involved in neuronal migration, axon growth, pathfinding, and fasciculation on the axons of differentiating neurons. May play diverse roles in the spermatogenesis including in the adhesion of spermatocytes and spermatids to Sertoli cells and for their normal differentiation into mature spermatozoa.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) lacks two alternate in-frame exons compared to variant 3. The resulting isoform (1, also known as D) has the same N- and C-termini but is shorter compared to isoform A.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (1)

Other Versions

Customer Reviews 
Loading...