Neurotensin Receptor 2 (NTSR2) (NM_012344) Human Untagged Clone
CAT#: SC115397
NTSR2 (untagged)-Human neurotensin receptor 2 (NTSR2)
CNY 3,656.00
Cited in 1 publication. |
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | NTR2 |
Vector | pCMV6-XL4 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_012344, the custom clone sequence may differ by one or more nucleotides
ATGGAAACCAGCAGCCCGCGGCCCCCGCGGCCCAGCTCCAACCCGGGGCTGAGCCTGGACGCCCGGCTGG GCGTGGACACTCGCCTCTGGGCCAAGGTGCTGTTCACCGCGCTCTACGCACTCATCTGGGCGCTGGGCGC GGCGGGCAATGCGCTGTCCGTGCACGTGGTGCTGAAGGCGCGGGCCGGGCGCGCGGGGCGCCTGCGCCAC CACGTGCTCAGCCTGGCGCTCGCGGGCCTGCTGCTGCTGCTGGTCGGCGTGCCGGTGGAGCTCTACAGCT TCGTGTGGTTCCACTACCCCTGGGTCTTCGGCGACCTGGGCTGCCGCGGCTACTACTTCGTGCACGAGCT GTGCGCCTACGCCACGGTGCTGAGCGTGGCAGGCCTGAGCGCCGAGCGCTGCCTAGCCGTGTGCCAGCCC CTGCGTGCCCGCAGCCTGCTGACGCCACGCCGGACCCGGTGGCTGGTGGCGCTCTCGTGGGCCGCCTCGC TCGGCCTCGCCCTGCCCATGGCCGTCATCATGGGGCAGAAGCACGAACTCGAGACGGCGGACGGGGAGCC GGAGCCCGCCTCGCGAGTGTGCACGGTGCTGGTGAGCCGCACCGCGCTCCAAGTCTTTATCCAGGTGAAT GTGCTGGTGTCCTTCGTGCTCCCCTTGGCACTAACTGCTTTCCTGAATGGGGTCACAGTGAGCCACCTGC TGGCCCTCTGCTCCCAAGTGCCGTCCACTTCTACCCCGGGCAGCTCCACCCCCAGCCGCCTGGAGCTGCT GAGTGAGGAGGGTCTCCTCAGCTTCATCGTATGGAAGAAGACCTTTATCCAGGGAGGCCAGGTCAGCCTG GTGAGACATAAAGACGTGCGCCGGATCCGCAGCCTCCAGCGCAGCGTCCAGGTTCTCAGAGCCATCGTGG TCATGTATGTCATCTGCTGGCTGCCGTACCATGCCCGCAGGCTCATGTACTGCTACGTACCTGATGACGC GTGGACTGACCCACTGTACAATTTCTACCACTACTTCTACATGGTGACCAACACACTTTTCTACGTCAGC TCAGCTGTGACTCCTCTTCTCTACAACGCCGTGTCCTCCTCCTTCAGAAAACTCTTCCTGGAAGCCGTCA GCTCCCTGTGTGGAGAGCACCACCCCATGAAGCGGTTACCCCCGAAGCCCCAGAGTCCCACCCTAATGGA TACAGCTTCAGGCTTTGGGGATCCCCCAGAAACCCGGACCTGA |
Restriction Sites | Please inquire |
ACCN | NM_012344 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_012344.2, NP_036476.1 |
RefSeq Size | 1700 bp |
RefSeq ORF | 1233 bp |
Locus ID | 23620 |
UniProt ID | O95665 |
Protein Families | Druggable Genome, GPCR, Transmembrane |
Protein Pathways | Neuroactive ligand-receptor interaction |
Gene Summary | The protein encoded by this gene belongs to the G protein-coupled receptor family that activate a phosphatidylinositol-calcium second messenger system. Binding and pharmacological studies demonstrate that this receptor binds neurotensin as well as several other ligands already described for neurotensin NT1 receptor. However, unlike NT1 receptor, this gene recognizes, with high affinity, levocabastine, a histamine H1 receptor antagonist previously shown to compete with neurotensin for low-affinity binding sites in brain. These activities suggest that this receptor may be of physiological importance and that a natural agonist for the receptor may exist. [provided by RefSeq, Jul 2008] |
Citations (1)
The use of this cDNA Clones has been cited in the following citations: |
---|
Neurotensin receptor type 2 protects B-cell chronic lymphocytic leukemia cells from apoptosis
,Abbaci, A;Talbot, H;Saada, S;Gachard, N;Abraham, J;Jaccard, A;Bordessoule, D;Fauchais, AL;Naves, T;Jauberteau, MO;,
Oncogene
,PubMed ID 29059151
[NTSR2]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC205343 | NTSR2 (Myc-DDK-tagged)-Human neurotensin receptor 2 (NTSR2) |
CNY 3,656.00 |
|
RC205343L1 | Lenti ORF clone of Human neurotensin receptor 2 (NTSR2), Myc-DDK-tagged |
CNY 6,056.00 |
|
RC205343L2 | Lenti ORF clone of Human neurotensin receptor 2 (NTSR2), mGFP tagged |
CNY 5,890.00 |
|
RC205343L3 | Lenti ORF clone of Human neurotensin receptor 2 (NTSR2), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC205343L4 | Lenti ORF clone of Human neurotensin receptor 2 (NTSR2), mGFP tagged |
CNY 5,890.00 |
|
RG205343 | NTSR2 (tGFP-tagged) - Human neurotensin receptor 2 (NTSR2) |
CNY 5,256.00 |
其它Neurotensin Receptor 2产品