Neurotensin Receptor 2 (NTSR2) (NM_012344) Human Untagged Clone

CAT#: SC115397

NTSR2 (untagged)-Human neurotensin receptor 2 (NTSR2)



  "NM_012344" in other vectors (6)

CNY 3,656.00


货期*
现货

规格
    • 10 ug

Cited in 1 publication.

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit polyclonal anti-NTR2 antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms NTR2
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_012344, the custom clone sequence may differ by one or more nucleotides


ATGGAAACCAGCAGCCCGCGGCCCCCGCGGCCCAGCTCCAACCCGGGGCTGAGCCTGGACGCCCGGCTGG
GCGTGGACACTCGCCTCTGGGCCAAGGTGCTGTTCACCGCGCTCTACGCACTCATCTGGGCGCTGGGCGC
GGCGGGCAATGCGCTGTCCGTGCACGTGGTGCTGAAGGCGCGGGCCGGGCGCGCGGGGCGCCTGCGCCAC
CACGTGCTCAGCCTGGCGCTCGCGGGCCTGCTGCTGCTGCTGGTCGGCGTGCCGGTGGAGCTCTACAGCT
TCGTGTGGTTCCACTACCCCTGGGTCTTCGGCGACCTGGGCTGCCGCGGCTACTACTTCGTGCACGAGCT
GTGCGCCTACGCCACGGTGCTGAGCGTGGCAGGCCTGAGCGCCGAGCGCTGCCTAGCCGTGTGCCAGCCC
CTGCGTGCCCGCAGCCTGCTGACGCCACGCCGGACCCGGTGGCTGGTGGCGCTCTCGTGGGCCGCCTCGC
TCGGCCTCGCCCTGCCCATGGCCGTCATCATGGGGCAGAAGCACGAACTCGAGACGGCGGACGGGGAGCC
GGAGCCCGCCTCGCGAGTGTGCACGGTGCTGGTGAGCCGCACCGCGCTCCAAGTCTTTATCCAGGTGAAT
GTGCTGGTGTCCTTCGTGCTCCCCTTGGCACTAACTGCTTTCCTGAATGGGGTCACAGTGAGCCACCTGC
TGGCCCTCTGCTCCCAAGTGCCGTCCACTTCTACCCCGGGCAGCTCCACCCCCAGCCGCCTGGAGCTGCT
GAGTGAGGAGGGTCTCCTCAGCTTCATCGTATGGAAGAAGACCTTTATCCAGGGAGGCCAGGTCAGCCTG
GTGAGACATAAAGACGTGCGCCGGATCCGCAGCCTCCAGCGCAGCGTCCAGGTTCTCAGAGCCATCGTGG
TCATGTATGTCATCTGCTGGCTGCCGTACCATGCCCGCAGGCTCATGTACTGCTACGTACCTGATGACGC
GTGGACTGACCCACTGTACAATTTCTACCACTACTTCTACATGGTGACCAACACACTTTTCTACGTCAGC
TCAGCTGTGACTCCTCTTCTCTACAACGCCGTGTCCTCCTCCTTCAGAAAACTCTTCCTGGAAGCCGTCA
GCTCCCTGTGTGGAGAGCACCACCCCATGAAGCGGTTACCCCCGAAGCCCCAGAGTCCCACCCTAATGGA
TACAGCTTCAGGCTTTGGGGATCCCCCAGAAACCCGGACCTGA


Restriction Sites Please inquire     
ACCN NM_012344
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_012344.2, NP_036476.1
RefSeq Size 1700 bp
RefSeq ORF 1233 bp
Locus ID 23620
UniProt ID O95665
Protein Families Druggable Genome, GPCR, Transmembrane
Protein Pathways Neuroactive ligand-receptor interaction
Gene Summary The protein encoded by this gene belongs to the G protein-coupled receptor family that activate a phosphatidylinositol-calcium second messenger system. Binding and pharmacological studies demonstrate that this receptor binds neurotensin as well as several other ligands already described for neurotensin NT1 receptor. However, unlike NT1 receptor, this gene recognizes, with high affinity, levocabastine, a histamine H1 receptor antagonist previously shown to compete with neurotensin for low-affinity binding sites in brain. These activities suggest that this receptor may be of physiological importance and that a natural agonist for the receptor may exist. [provided by RefSeq, Jul 2008]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (1)

Other Versions

Customer Reviews 
Loading...